Marker

Marker Detail

Marker
Marker name AUT10113
Map name SSR
Chromosome No. 1
Start (bp):Build5 2,122,838 -->Get Sequence
End (bp):Build5 2,123,125
Direction:Build5 +
Length:Build5 288
Start (bp):Ver1.0 2,123,838 -->Get Sequence
End (bp):Ver1.0 2,124,125
Direction:Ver1.0 +
Length:Ver1.0 288
Primer forward AAATGCCAAATGGAGGGATCG
Primer reverse ACTTCGTCCTGGTAATTCCATGTGC
Repeat motif (AG)16


Chromosome: 1 ,  position: 2,122,838 - 2,123,125 bp

   Now loading


#
#
/rice/oryzabase