Marker

Marker Detail

Marker
Marker name AUT10100
Map name SSR
Chromosome No. 1
Start (bp):Build5 1,775,710 -->Get Sequence
End (bp):Build5 1,775,947
Direction:Build5 +
Length:Build5 238
Start (bp):Ver1.0 1,776,710 -->Get Sequence
End (bp):Ver1.0 1,776,947
Direction:Ver1.0 +
Length:Ver1.0 238
Primer forward GTTGAGCTGAGAGGTGATGAACC
Primer reverse CTTCTGTTCTTGGCTTGGTTTCC
Repeat motif (CCG)9


Chromosome: 1 ,  position: 1,775,710 - 1,775,947 bp

   Now loading


#
#
/rice/oryzabase