Marker

Marker Detail

Marker
Marker name AUT10090
Map name SSR
Chromosome No. 1
Start (bp):Build5 1,658,078 -->Get Sequence
End (bp):Build5 1,658,223
Direction:Build5 +
Length:Build5 146
Start (bp):Ver1.0 1,659,078 -->Get Sequence
End (bp):Ver1.0 1,659,223
Direction:Ver1.0 +
Length:Ver1.0 146
Primer forward GATTTCGATCTGACTGTCCCTAGC
Primer reverse CTTTCTTTCTCAGCTGCTTGTGC
Repeat motif (CT)15


Chromosome: 1 ,  position: 1,658,078 - 1,658,223 bp

   Now loading


#
#
/rice/oryzabase