Marker

Marker Detail

Marker
Marker name AUT10087
Map name SSR
Chromosome No. 1
Start (bp):Build5 1,642,243 -->Get Sequence
End (bp):Build5 1,642,432
Direction:Build5 +
Length:Build5 190
Start (bp):Ver1.0 1,643,243 -->Get Sequence
End (bp):Ver1.0 1,643,432
Direction:Ver1.0 +
Length:Ver1.0 190
Primer forward AGTGTCAGAACCAGGATGAAATGC
Primer reverse AGTGCAGCTTCAGCCATGAGG
Repeat motif (GGC)8


Chromosome: 1 ,  position: 1,642,243 - 1,642,432 bp

   Now loading


#
#
/rice/oryzabase