Marker

Marker Detail

Marker
Marker name AUT10085
Map name SSR
Chromosome No. 1
Start (bp):Build5 1,622,417 -->Get Sequence
End (bp):Build5 1,622,558
Direction:Build5 +
Length:Build5 142
Start (bp):Ver1.0 1,623,417 -->Get Sequence
End (bp):Ver1.0 1,623,558
Direction:Ver1.0 +
Length:Ver1.0 142
Primer forward CAGAACCAGGGCTTTGTAAGAGG
Primer reverse AACCTGTGGTTGCATTGTGTAGG
Repeat motif (TC)12


Chromosome: 1 ,  position: 1,622,417 - 1,622,558 bp

   Now loading


#
#
/rice/oryzabase