Marker

Marker Detail

Marker
Marker name AUT10063
Map name SSR
Chromosome No. 1
Start (bp):Build5 1,253,595 -->Get Sequence
End (bp):Build5 1,253,818
Direction:Build5 +
Length:Build5 224
Start (bp):Ver1.0 1,254,595 -->Get Sequence
End (bp):Ver1.0 1,254,818
Direction:Ver1.0 +
Length:Ver1.0 224
Primer forward CTCGGCTAGTGACGATTTCTTGG
Primer reverse ACGTCGTGGTAGGCGACATAGC
Repeat motif (GCG)8


Chromosome: 1 ,  position: 1,253,595 - 1,253,818 bp

   Now loading


#
#
/rice/oryzabase