Marker

Marker Detail

Marker
Marker name AUT10006
Map name SSR
Chromosome No. 1
Start (bp):Build5 84,323 -->Get Sequence
End (bp):Build5 84,440
Direction:Build5 +
Length:Build5 118
Start (bp):Ver1.0 85,323 -->Get Sequence
End (bp):Ver1.0 85,440
Direction:Ver1.0 +
Length:Ver1.0 118
Primer forward CCGCGAATCCATTCAGACTGC
Primer reverse TCTAGGAGGAGATGGCGGAGTAGC
Repeat motif (GA)12


Chromosome: 1 ,  position: 84,323 - 84,440 bp

   Now loading


#
#
/rice/oryzabase