Marker

Marker Detail

Marker
Marker name AUT10049
Map name SSR
Chromosome No. 1
Start (bp):Ver1.0 747,091 -->Get Sequence
End (bp):Ver1.0 747,249
Direction:Ver1.0 +
Length:Ver1.0 159
Primer forward GCTTTGGTATTTGCAGGTTCACG
Primer reverse CTATTGCTCGAACACTTTGCTTCTCC
Repeat motif (TG)20
/rice/oryzabase