Marker

Marker Detail

Marker
Marker name AUT10031
Map name SSR
Chromosome No. 1
Start (bp):Ver1.0 498,569 -->Get Sequence
End (bp):Ver1.0 498,865
Direction:Ver1.0 +
Length:Ver1.0 297
Primer forward CCATATCTACTCCCGGTTTCTGC
Primer reverse GTCGAAGCAGCCGTAGTAGTGG
Repeat motif (CCA)8
/rice/oryzabase