National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS01437 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Kato K, Orihara-Ono M, Awasaki T.
Multiple lineages enable robust development of the neuropil-glia architecture in adult Drosophila.
Development (2020) 147(5) [ PubMed ID = 32051172 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG7223 
 Symbol htl 
 Full Name heartless 
 Synonym DTRK(FR1), Dfr1, HTL/FGFR1, DFGF-R1, CT39172, EMS2, CG7223, Dfr-1, DFR1, HD-38, Fr1, i79, Tk1, DFR-1, Dtk1, Htl, i150, j372, DFGF-R2, FGFR2, DFR1/DFGF-R2, i100, heartless, dtk1, CT22273, FGFR, FGF-R2, FR1, DPR3, DmHD-38 
 FBgn FBgn0010389 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 3 out of 3 
 Transcripts
CG7223-RC, CG7223-RA, CG7223-RB 
 Accession NM_169785NM_169784NM_079670
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH02197.N 
 21bp_seq_sense_
TCGGTTGTATTTGCTGTTGTA 
 21bp_seq_antisense
TACAACAGCAAATACAACCGA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.