National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS00245 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG4654 
 Symbol Dp 
 Full Name DP transcription factor 
 Synonym TFPD2, dDP1, CG4654, DP, DP1, DDP1, l(2)vr10, l(2)49Fk, Dp1, DmDP, dDp, 49Fk, vr10, dDP, dp 
 FBgn FBgn0011763 
 Gene Loc. 2R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 3 out of 3 
 Transcripts
CG4654-RC, CG4654-RB, CG4654-RA 
 Accession NM_001274020NM_165974NM_057691
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH00330.N 
 21bp_seq_sense_
CAGACTAATGTTCACTCTCTA 
 21bp_seq_antisense
TAGAGAGTGAACATTAGTCTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.