National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock request_help.gif
Stock Detail
 TRiP No HMS00159 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG9177 
 Symbol eIF5 
 Full Name eIF5 
 Synonym anon-EST:fe3C6, CG9177, EIf5 
 FBgn FBgn0030719 
 Gene Loc.
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 7 out of 7 
 Transcripts
CG9177-RF, CG9177-RG, CG9177-RB, CG9177-RE, CG9177-RA, CG9177-RC, CG9177-RD 
 Accession NM_206755NM_206754NM_132870NM_206756NM_167477NM_206758NM_206757
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH00345.N 
 21bp_seq_sense_
CTGGATACATTTGTTAAGTAA 
 21bp_seq_antisense
TTACTTAACAAATGTATCCAG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.