National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00029 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Suzuta S, Nishida H, Ozaki M, Kohno N, Le TD, Inoue YH.
Metformin suppresses progression of muscle aging via activation of the AMP kinase-mediated pathways in Drosophila adults.
Eur Rev Med Pharmacol Sci (2022) 26(21) 8039-8056 [ PubMed ID = 36394755 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG8057 
 Symbol alc 
 Full Name alicorn 
 Synonym betaAMPK, alicorn, CG8057, FBgn0033383, l(2)45Ad, AMPKbeta, 8057 
 FBgn FBgn0260972 
 Gene Loc. 2R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 2 out of 2 
 Transcripts
CG8057-RB, CG8057-RA 
 Accession NM_206061NM_136616
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01204.N2 
 21bp_seq_sense_
CAGCGAGAACGTGACCAACTA 
 21bp_seq_antisense
TAGTTGGTCACGTTCTCGCTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.