Kyorin University
Quick Search        
KYORIN-Fly - Fly Stocks of Kyorin University -KYORIN-Fly - Fly Stocks of Kyorin University -KYORIN-Fly - Fly Stocks of Kyorin University -
Home Home
Japanese | English 
Untitled Document
 Detail Information: E-17201


For provision of the fly stocks, the MTA execution between user and Kyorin University is now required.
The procedure of the MTA execution, you can proceed to procedure by click "Order" button of appropriate stock(s).

 Strain Information
Stock number E-17201
EHIME-Fly stock Number E-17201
Status LIVE
Species D. montana
Strain 1021.13-TC
Subspecies na
Genotypes +
Linkage na
Chromosome genotype na
Genetic Background na
Locality kanagawa
Country Japan
Complex montana
Subgroup montana
Group virilis
Subgenus Drosophila
Genus Drosophila
Collection Year unknown
Collector or Origin na
Tucson _Sandiego_ No na
Subcategory Wildtype
genome2007 sequence COI
TCGCGACAATGATTATTCTCAACAAATCATAAAGATATTGGAACATTATATTTTATCTTT
GGTGCTTGAGCAGGAATAGTAGGAACATCTTTAAGAATTTTAATTCGAGCTGAATTAGGT
CACCCAGGAGCTTTAATTGGAGATGACCAAATTTATAATGTTATTGTTACTGCTCATGCT
TTTGTTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTCGGTAATTGACTT
GTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCCCGAATAAACAATATAAGATTT
TGACTATTACCTCCTGCTTTATCCTTACTTTTAGTTAGAAGAATAGTTGAAAATGGAGCT
GGGACAGGATGAACCGTATACCCCCCATTATCGGCAGGAATTGCTCATGGAGGAGCTTCT
GTTGATCTAGCTATTTTTTCTTTACATTTAGCTGGAATCTCTTCAATTTTAGGAGCTGTA
AATTTCATTACAACTGTAATTAATATACGATCTTCAGGAATTACTTTAGACCGAATACCT
TTATTTGTTTGATCAGTTGTAATTACAGCTTTATTACTACTTTTATCCTTACCAGTTTTA
GCCGGAGCTATCACTATATTATTAACAGACCGAAATCTTAACACCTCATTTTTTGACCCG
GCTGGTGGAGGGGATCCAATTTTATACCAACACTTATTTTGATTTTTTGGTCACCCAGAA
GTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTAGTCAAGAATCA
GGTAAAAAGGAAACTTTTGGATCTTTAGGAATAATTTATGCAATATTAGCAATTGGATTA
TTAGGGTTTATTGTATGAGCACATCATATATTTACAGTTGGAATAGACGTAGACACTCGA
GCTTACTTCACATCAGCAACAATAATTATTGCTGTACCAACAGGTATTAAAATTTTTAGT
TGACTTGCTACTTTACATGGTACACAACTTTCTTACTCTCCAGCTATTTTATGAGCTTTA
GGATTTGTATTTTTATTTACAGTTGGAGGATTAACTGGAGTTGTATTAGCAAATTCATCA
GTAGATATTATTTTACATGACACATACTATGTTGTTGCCCACTTTCATTATGTTTTATCA
ATAGGAGCTGTATTTGCTATTATAGCAGGATTTGTTCATTGATACCCTTTATTTACTGGT
TTAACTATAAATAATAAGTGATTAAAAAGTCAATTTATTATTATATTTATTGGAGTAAAT
CTTACTTTTTTCCCCCAACATTTCCTTGGACTAGCTGGAATACCTCGTCGTTATTCTGAT
TACCCAGACGCTTACACAACATGAAATGTAATTTCAACTATTGGTTCATCTATTTCTTTA
TTAGGGATTTTATTTTTTTTCTACATTATTTGAGAAAGTTTAGTTTCTCAACGTCAGGTT
ATTTACCCTATTCAATTGAATTCTTCAATTGAATGATACCAAAATACTCCCCCTGCTGAA
CATAGATATTCTGAATTACCTTTATTAACTAATTAA
genome2007 sequence rDNA ITS
TGAACCTGCGGAAGGATCATTATTGTATAATGTTCATTTCCGTTAATAAAAACAATTTTA
TATATAGAAATATATATAAAATTTTTCTGAATATAAATAAATATTCATTTAAACACATTT
ACACATGCTTATGCCCAATTAATATCTAATTATATAATATCTGACAATTTCCATTTGGGA
TTTGTGTGTGTTTATGCGTTTTTATGGAGAAAAAACTTGCGTGTATATGTACCATAATAT
ACATGCGTTGCACAGATGTATTGTTCATTATTATATGCGCATACATTATATAAACGCAAC
AACCTAAATTTAAAGTGTTGTACCTGTTTTCAGGTTAATGCTTTGCATATTTCTATAAAA
ATATTTAATTTTTGTATCTATATAAAAATGTTATTCATATATACCATGTTTTTAAAGAAT
ATGTAAGACTAAGACATTTCGCAACACTGTTTAGGTATAAAAAGATTTATTGAAGGAATT
GATATATGCCAGTAAAATGGTGTATTTTTAATTTCTTTCAATAAACATATTTGTGACGTA
ATGAAATAAACCAAAACAAATTAATCACTCTAAGCGGTGGATCACTCGGCTCATGG
Stock Temperature 23°C
Food Type corn
Reference
[Please submit your publication]
na
Request



Back

Copyright (c) Department of Biology, School of Medicine,
Kyorin University All rights reserved.
The KYORIN-Fly is part of the National BioResource Project started in 2002.