Kyorin University
Quick Search        
KYORIN-Fly - Fly Stocks of Kyorin University -KYORIN-Fly - Fly Stocks of Kyorin University -KYORIN-Fly - Fly Stocks of Kyorin University -
Home Home
Japanese | English 
Untitled Document
 Detail Information: E-12901


For provision of the fly stocks, the MTA execution between user and Kyorin University is now required.
The procedure of the MTA execution, you can proceed to procedure by click "Order" button of appropriate stock(s).

 Strain Information
Stock number E-12901
EHIME-Fly stock Number E-12901
Status LIVE
Species D. bocki
Strain IR2-37
Subspecies na
Genotypes +
Linkage na
Chromosome genotype na
Genetic Background na
Locality Okinawa
Country Japan
Complex kikkawai
Subgroup montium
Group melanogaster
Subgenus Sophophora
Genus Drosophila
Collection Year 1979
Collector or Origin na
Tucson _Sandiego_ No na
Subcategory Wildtype
genome2007 sequence COI
TCGCGACAATGATTATTTTCAACAAATCATAAAGATATTGGAACTTTATATTTTATTTTT
GGAGCTTGAGCAGGAATAGTTGGAACATCTTTAAGAATTTTAATTCGAGCTGAATTAGGA
CATCCCGGAGCTTTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCCCATGCT
TTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTA
GTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTT
TGATTACTTCCTCCTGCTCTTTCACTTTTATTGGTAAGAAGAATAGTTGAAAATGGAGCT
GGTACTGGATGAACAGTATATCCACCTTTATCTTCAGGAATTGCTCATGGAGGAGCTTCT
GTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTGTA
AATTTTATTACAACAGTTATTAATATACGATCAACAGGAATTACTTTAGATCGAATACCT
TTATTTGTATGATCAGTTGTAATTACTGCTTTATTACTTTTATTATCATTACCAGTATTA
GCAGGAGCAATTACAATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGACCCA
GCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAA
GTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCACATTATTAGTCAAGAATCA
GGAAAAAAGGAAACTTTCGGATCTTTAGGGATAATTTATGCAATACTTGCTATTGGATTA
TTAGGATTTATTGTATGAGCCCACCATATATTTACAGTAGGGATAGATGTAGATACACGA
GCTTATTTTACATCAGCAACAATGATTATTGCAGTACCTACTGGAATTAAAATTTTCAGA
TGATTAGCAACTCTTCATGGAACTCAATTATCTTATTCACCAGCCATTTTATGAGCTTTA
GGATTTGTTTTCTTATTTACTGTTGGAGGATTAACAGGAGTAGTTTTAGCTAATTCATCT
GTTGATATTATTCTTCATGATACTTACTATGTTGTAGCTCACTTTCATTACGTTTTATCT
ATAGGAGCAGTATTTGCTATTATAGCTGGGTTTATCCATTGATACCCTTTATTTACGGGA
TTAACATTAAATTCTAAATGATTAAAAAGTCAATTTATTATTATATTTATTGGAGTAAAT
TTAACATTTTTTCCTCAACATTTTTTAGGATTAGCTGGTATACCTCGACGTTATTCAGAT
TATCCAGATGCTTACACAACTTGAAATGTTGTATCAACTATTGGGTCTACAATTTCTTTA
TTAGGTATTTTATTTTTTTTCTATATTATTTGAGAAAGTTTAGTATCACAACGACAAGTA
ATTTATCCAATTCAACTAAATTCCTCAATTGAATGATATCAAAATACTCCACCAGCTGAA
CATAGTTATTCTGAATTACCACTTTTAACTAATTAA
genome2007 sequence rDNA ITS
TGAACCTGCGGAAGGATCATTATAGTATATAATTTTCCTTACCGTTAATATATAATATTA
TTAATAATATTAATGAAATTGCCAAAGAAAAAAAAATTAACATTGTAAACAGCAACCAAG
CAAAGCTGAATGTTAAATGAATAATAAAAATCAATTAATGGAAAATAAAAAATTTGCGTG
TATATGGACCATAATATACAGGCGTTGCGTAATGTATTGTTCATTATTATTATGCGCATA
CATTGGTTAATGCAACAATCTGAAATGCATAATGTTGTACCTGGTTATTCAGGTTAATGT
TTTATATAAAATTACCAATATATTATATCGAAAACAAAAAGGCTTATATTATAAAAATGA
TTAAAACTACAGATATGTATATTGTTTATATGAAACTAAGACTTTTCGCAACATTTATTT
TGGATTTAAAAAAAAAAAAAAATAACAATGTTAAATTTATTGAAGGAATTGATATATGCC
AGTAAAATGGTGTATTTTTAATTTCTTTCAATAAAAACATTTCTGATGATATATAGAAAC
CAAATTATTAAAACTCTAAGCGGTGGATCACTCGGCTCATGG
Stock Temperature 23°C
Food Type corn
Reference
[Please submit your publication]
na
Request



Back

Copyright (c) Department of Biology, School of Medicine,
Kyorin University All rights reserved.
The KYORIN-Fly is part of the National BioResource Project started in 2002.