HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Technical notes
Reference Feedback

Mutants under screening
Progress state
How to propose a new target
Request form

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 784
Allele tm784
Sequence Name F45H11.1
CGC Name sptf-1
Worm Base Allele tm784
CGC Name sptf-1
Sequence F45H11.1
Phenotype lethal or sterile. Dr. P. Sengputa: some dyf defects in both the amphid and phasmid. Dr. G. Jansen: L1-L2 Let.
Mutation site 6887/6888-7618/7619 (731 bp deletion)
Chromosome I
Putative gene structure join(6021..6176, 6238..6407, 7049..7253, 8318..8528, 10563..10690, 10901..10927)
Map position 4.95
Balancer Not Yet Balanced
Map position of balancer
Sequence of primers IntFwd:GCGGAGAAAACCCTTTATCA,ExtFwd:CAGGTCCCATTCCAAATGAG,IntRev:CACTTTCAGAACCACTGCTT,ExtRev:AGAAGTTCCACGAGCACTAA
Distributed lab
Depositor Dr. S. Mitani
References  Please submit your publication
González-Barrios M, Fierro-González JC, Krpelanova E, Mora-Lorca JA, Pedrajas JR, Peñate X, Chavez S, Swoboda P, Jansen G, Miranda-Vizuete A.
Cis- and trans-regulatory mechanisms of gene expression in the ASJ sensory neuron of Caenorhabditis elegans.
Genetics 2015 200(1) 123-34 
[ PubMed ID = 25769980 ] [ RRC reference ]