HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Reference Feedback

Mutants under screening
Progress state

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 2530
Allele tm2530
Sequence Name Y51H1A.4
CGC Name ing-3
Worm Base Allele tm2530
CGC Name ing-3
Sequence Y51H1A.4
Phenotype homozygous viable
Mutation site 21827/21828-22792/22793 (965 bp deletion)
Chromosome II
Putative gene structure join(19135..19162, 19229..19300, 19354..19457, 20843..21367, 22500..23114, 25209..25337)
Map position 20.7
Balancer
Map position of balancer
Sequence of primers IntRev:GCCCACACTAACATGACGAT,ExtRev:TCGCACTATTTCTGCTGGGA,IntFwd:GCGTGCTAGCTCAACGCAAA,ExtFwd:CTCCACAATCCGCGTGCTAG
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication