HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Reference Feedback

Mutants under screening
Progress state

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 2530
Allele tm2530
Sequence Name Y51H1A.4
CGC Name ing-3
Worm Base Allele tm2530
CGC Name ing-3
Sequence Y51H1A.4
Phenotype homozygous viable
Mutation site 21827/21828-22792/22793 (965 bp deletion)
Chromosome II
Putative gene structure join(19135..19162, 19229..19300, 19354..19457, 20843..21367, 22500..23114, 25209..25337)
Map position 20.7
Balancer
Map position of balancer
Sequence of primers IntRev:GCCCACACTAACATGACGAT,ExtRev:TCGCACTATTTCTGCTGGGA,IntFwd:GCGTGCTAGCTCAACGCAAA,ExtFwd:CTCCACAATCCGCGTGCTAG
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication
Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63 
[ PubMed ID = 26811384 ] [ RRC reference ]

Wohlschlager T, Butschi A, Grassi P, Sutov G, Gauss R, Hauck D, Schmieder SS, Knobel M, Titz A, Dell A, Haslam SM, Hengartner MO, Aebi M, Künzler M.
Methylated glycans as conserved targets of animal and fungal innate defense.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(27) E2787-96 
[ PubMed ID = 24879441 ] [ RRC reference ]

Luo J, Shah S, Riabowol K, Mains PE.
The Caenorhabditis elegans ing-3 gene regulates ionizing radiation-induced germ-cell apoptosis in a p53-associated pathway.
Genetics 2008 181(2) 473-82 
[ PubMed ID = 19015549 ] [ RRC reference ]