HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Technical notes
Reference Feedback

Mutants under screening
Progress state
How to propose a new target
Request form

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 1991
Allele tm1991
Sequence Name C27B7.4
CGC Name rad-26
Worm Base Allele tm1991
CGC Name rad-26
Sequence C27B7.4
Phenotype homozygous viable. Dr. M. Bastiani: axon regeneration defect. Dr. S. Kennedy: some nuclear RNAi response.
Mutation site 8189/8190-TT-8936/8937 (747 bp deletion + 2 bp insertion)
Chromosome IV
Putative gene structure join(4580..4667, 4719..4794, 7147..7535, 7585..7743, 7793..8185, 8230..8463, 8790..9535, 9615..10154, 10233..11196, 11240..11389, 11436..11521)
Map position 4
Balancer
Map position of balancer
Sequence of primers ExtFwd:TCGGCGCAGAAGATCTCGAT,IntFwd:GTGTTGGAAGCCCAGCGACT,ExtRev:CATGCGGAGAATGCCATTAG,IntRev:AGCACGTGAGTTCGTTGTAG
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication
Leight ER, Murphy JT, Fantz DA, Pepin D, Schneider DL, Ratliff TM, Mohammad DH, Herman MA, Kornfeld K.
Conversion of the LIN-1 ETS protein of Caenorhabditis elegans from a SUMOylated transcriptional repressor to a phosphorylated transcriptional activator.
Genetics 2015 199(3) 761-75 
[ PubMed ID = 25567989 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J. Neurosci. 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]