HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Reference Feedback

Mutants under screening
Progress state

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 920
Allele tm920
Sequence Name F53H8.1
CGC Name apm-3
Worm Base Allele tm920
CGC Name apm-3
Sequence F53H8.1
Phenotype homozygous viable. Dr. M. Barr: PKD-2::GFP localization=WT. Dr. G. Hermann: loss of gut granules (Glo). Dr. Y. Jin: no specific neuronal phenotype is found. Dr. O. Blacque: dye-filling normal.
Mutation site 18182/18183-18906/18907 (724 bp deletion)
Chromosome X
Putative gene structure join(17230..17264, 17324..17402, 17461..17566, 17633..17745, 17793..18074, 18513..18626, 18671..18744, 18796..18898, 19757..19849)
Map position -18.89
Balancer
Map position of balancer
Sequence of primers ExtFwd:TATAGTAGTGGACCTCTCCT,IntFwd:CTCCTCTTCACGCATTTGAC,IntRev:CGTGACTCGCCACCAAATTG,ExtRev:GTCGAACGCGATTCTTCCGT
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication