HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Reference Feedback

Mutants under screening
Progress state

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 920
Allele tm920
Sequence Name F53H8.1
CGC Name apm-3
Worm Base Allele tm920
CGC Name apm-3
Sequence F53H8.1
Phenotype homozygous viable. Dr. M. Barr: PKD-2::GFP localization=WT. Dr. G. Hermann: loss of gut granules (Glo). Dr. Y. Jin: no specific neuronal phenotype is found. Dr. O. Blacque: dye-filling normal.
Mutation site 18182/18183-18906/18907 (724 bp deletion)
Chromosome X
Putative gene structure join(17230..17264, 17324..17402, 17461..17566, 17633..17745, 17793..18074, 18513..18626, 18671..18744, 18796..18898, 19757..19849)
Map position -18.89
Balancer
Map position of balancer
Sequence of primers ExtFwd:TATAGTAGTGGACCTCTCCT,IntFwd:CTCCTCTTCACGCATTTGAC,IntRev:CGTGACTCGCCACCAAATTG,ExtRev:GTCGAACGCGATTCTTCCGT
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication
Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol. Biol. Cell 2014 25(7) 1073-96 
[ PubMed ID = 24501423 ] [ RRC reference ]

Hermann GJ, Scavarda E, Weis AM, Saxton DS, Thomas LL, Salesky R, Somhegyi H, Curtin TP, Barrett A, Foster OK, Vine A, Erlich K, Kwan E, Rabbitts BM, Warren K.
C. elegans BLOC-1 functions in trafficking to lysosome-related gut granules.
PLoS ONE 2012 7(8) e43043 
[ PubMed ID = 22916203 ] [ RRC reference ]

Gu M, Schuske K, Watanabe S, Liu Q, Baum P, Garriga G, Jorgensen EM.
Mu2 adaptin facilitates but is not essential for synaptic vesicle recycling in Caenorhabditis elegans.
J. Cell Biol. 2008 183(5) 881-92 
[ PubMed ID = 19047463 ] [ RRC reference ]

Rabbitts BM, Ciotti MK, Miller NE, Kramer M, Lawrenson AL, Levitte S, Kremer S, Kwan E, Weis AM, Hermann GJ.
glo-3, a novel Caenorhabditis elegans gene, is required for lysosome-related organelle biogenesis.
Genetics 2008 180(2) 857-71 
[ PubMed ID = 18780725 ] [ RRC reference ]

Currie E, King B, Lawrenson AL, Schroeder LK, Kershner AM, Hermann GJ.
Role of the Caenorhabditis elegans multidrug resistance gene, mrp-4, in gut granule differentiation.
Genetics 2007 177(3) 1569-82 
[ PubMed ID = 17947407 ] [ RRC reference ]

Grill B, Bienvenut WV, Brown HM, Ackley BD, Quadroni M, Jin Y.
C. elegans RPM-1 regulates axon termination and synaptogenesis through the Rab GEF GLO-4 and the Rab GTPase GLO-1.
Neuron 2007 55(4) 587-601 
[ PubMed ID = 17698012 ] [ RRC reference ]

Schroeder LK, Kremer S, Kramer MJ, Currie E, Kwan E, Watts JL, Lawrenson AL, Hermann GJ.
Function of the Caenorhabditis elegans ABC transporter PGP-2 in the biogenesis of a lysosome-related fat storage organelle.
Mol. Biol. Cell 2007 18(3) 995-1008 
[ PubMed ID = 17202409 ] [ RRC reference ]

Bae YK, Qin H, Knobel KM, Hu J, Rosenbaum JL, Barr MM.
General and cell-type specific mechanisms target TRPP2/PKD-2 to cilia.
Development 2006 133(19) 3859-70 
[ PubMed ID = 16943275 ] [ RRC reference ]

Hermann GJ, Schroeder LK, Hieb CA, Kershner AM, Rabbitts BM, Fonarev P, Grant BD, Priess JR.
Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.
Mol. Biol. Cell 2005 16(7) 3273-88 
[ PubMed ID = 15843430 ] [ RRC reference ]