HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Technical notes
Reference Feedback

Mutants under screening
Progress state
How to propose a new target
Request form

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 918
Allele tm918
Sequence Name B0432.2
CGC Name djr-1.1
Worm Base Allele tm918
CGC Name djr-1.1
Sequence B0432.2
Phenotype homozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. S. McIntire: normal locomotion.
Mutation site 33128/33129-33953/33954 (825 bp deletion)
Chromosome II
Putative gene structure join(33249..33380, 33574..33847, 34214..34371)
Map position -15.65
Balancer
Map position of balancer
Sequence of primers IntFwd:CAGAGCTTGTTGTACCGAAT,ExtRev:TATGTCCTCGTTACTCGGGT,IntRev:GGTGACTGCTGTCATTGGAT,ExtFwd:CGGTGAAAGAGATGCGATCA
Distributed lab
Depositor Dr. S. Mitani
References  Please submit your publication
Chen P, DeWitt MR, Bornhorst J, Soares FA, Mukhopadhyay S, Bowman AB, Aschner M.
Age- and manganese-dependent modulation of dopaminergic phenotypes in a C. elegans DJ-1 genetic model of Parkinson's disease.
Metallomics 2015 7(2) 289-98 
[ PubMed ID = 25531510 ] [ RRC reference ]

Bornhorst J, Chakraborty S, Meyer S, Lohren H, Brinkhaus SG, Knight AL, Caldwell KA, Caldwell GA, Karst U, Schwerdtle T, Bowman A, Aschner M.
The effects of pdr1, djr1.1 and pink1 loss in manganese-induced toxicity and the role of α-synuclein in C. elegans.
Metallomics 2014 6(3) 476-90 
[ PubMed ID = 24452053 ] [ RRC reference ]

Lee JY, Kim C, Kim J, Park C.
DJR-1.2 of Caenorhabditis elegans is induced by DAF-16 in the dauer state.
Gene 2013 524(2) 373-6 
[ PubMed ID = 23624124 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS One 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]

Lee JY, Song J, Kwon K, Jang S, Kim C, Baek K, Kim J, Park C.
Human DJ-1 and its homologs are novel glyoxalases.
Hum. Mol. Genet. 2012 21(14) 3215-25 
[ PubMed ID = 22523093 ] [ RRC reference ]

Cornejo Castro EM, Waak J, Weber SS, Fiesel FC, Oberhettinger P, Schütz M, Autenrieth IB, Springer W, Kahle PJ.
Parkinson's disease-associated DJ-1 modulates innate immunity signaling in Caenorhabditis elegans.
J Neural Transm (Vienna) 2010 117(5) 599-604 
[ PubMed ID = 20376509 ] [ RRC reference ]