HOME MUTANTS PROMOTER SEARCH FAQ & CONTACT  
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Technical notes
Reference Feedback

Mutants under screening
Progress state
How to propose a new target
Request form

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 541
Allele tm541
Sequence Name C02F12.5
CGC Name C02F12.5
Worm Base Allele tm541
CGC Name C02F12.5
Sequence C02F12.5
Phenotype homozygous viable
Mutation site 10918/10919-12127/12128 (1209 bp deletion)
Chromosome X
Putative gene structure complement (9487..9596, 9650..9784, 10204..10315, 10363..10414, 11722..11858, 11918..11998, 12045..12104, 12149..12163)
Map position -9.8
Balancer
Map position of balancer
Sequence of primers ExtRev:GTGAAATATCTCTCCCCAGA,ExtFwd:GATGACCCTTTGACGCATTT,IntFwd:TTCATTCGATCGCAAATATACA,IntRev:TTAGTAATGGTCGAAGCAAG
Distributed lab
Depositor Dr. S. Mitani
References  Please submit your publication
Feng H, Reece-Hoyes JS, Walhout AJ, Hope IA.
A regulatory cascade of three transcription factors in a single specific neuron, DVC, in Caenorhabditis elegans.
Gene 2012 494(1) 73-84 
[ PubMed ID = 22207033 ] [ RRC reference ]