HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Reference Feedback

Mutants under screening
Progress state

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 5256
Allele tm5256
Sequence Name Y37D8A.12
CGC Name Y37D8A.12
Worm Base Allele tm5256
CGC Name Y37D8A.12
Sequence Y37D8A.12
Phenotype homozygous viable.
Mutation site 61576/61577-61842/61843 (266 bp deletion)
Chromosome III
Putative gene structure join(61744..61803, 61862..62197, 62312..62449, 62610..63170, 63219..63365, 63413..63547)
Map position 19.36
Balancer
Map position of balancer
Sequence of primers ExtFwd:GCTCCCCTTTTCGTAGGGCT,ExtRev:ATCTTGGCCGAGCTCTCGCT,IntFwd:AACAGGATGCAGGGACGGGA,IntRev:AACGTACCGGATTCGCGGCA
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication