HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Reference Feedback

Mutants under screening
Progress state

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 1833
Allele tm1833
Sequence Name F55C5.4
CGC Name capg-2
Worm Base Allele tm1833
CGC Name capg-2
Sequence F55C5.4
Phenotype lethal or sterile. Dr. K. Hagstrom: maternal effect Unc, Sck, Ste, Pvl, abnormal staining in the germ cells.Dr. B.J. Meyer: Let.
Mutation site 9703/9704-GGCA-10561/10562 (858 bp deletion + 4 bp insertion)
Chromosome V
Putative gene structure join(9770..10074, 10121..10831, 10875..11256, 11330..11794, 11839..12266, 12653..13394)
Map position 3.98
Balancer Not Yet Balanced
Map position of balancer
Sequence of primers ExtRev:GATCCTCCAATTCACGTCGT,IntFwd:GGCCGCGCGAAAGAATTCGT,ExtFwd:TGCGCCCCAATGAGAAAGAC,IntRev:GCTGTCGCAGTTCCGAGAAT
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication