HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Technical notes
Reference Feedback

Mutants under screening
Progress state
How to propose a new target
Request form

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 1833
Allele tm1833
Sequence Name F55C5.4
CGC Name capg-2
Worm Base Allele tm1833
CGC Name capg-2
Sequence F55C5.4
Phenotype lethal or sterile. Dr. K. Hagstrom: maternal effect Unc, Sck, Ste, Pvl, abnormal staining in the germ cells.Dr. B.J. Meyer: Let.
Mutation site 9703/9704-GGCA-10561/10562 (858 bp deletion + 4 bp insertion)
Chromosome V
Putative gene structure join(9770..10074, 10121..10831, 10875..11256, 11330..11794, 11839..12266, 12653..13394)
Map position 3.98
Balancer Not Yet Balanced
Map position of balancer
Sequence of primers ExtRev:GATCCTCCAATTCACGTCGT,IntFwd:GGCCGCGCGAAAGAATTCGT,ExtFwd:TGCGCCCCAATGAGAAAGAC,IntRev:GCTGTCGCAGTTCCGAGAAT
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication
Clemons AM, Brockway HM, Yin Y, Kasinathan B, Butterfield YS, Jones SJ, Colaiácovo MP, Smolikove S.
akirin is required for diakinesis bivalent structure and synaptonemal complex disassembly at meiotic prophase I.
Mol. Biol. Cell 2013 24(7) 1053-67 
[ PubMed ID = 23363597 ] [ RRC reference ]

Csankovszki G, Collette K, Spahl K, Carey J, Snyder M, Petty E, Patel U, Tabuchi T, Liu H, McLeod I, Thompson J, Sarkeshik A, Yates J, Meyer BJ, Hagstrom K.
Three distinct condensin complexes control C. elegans chromosome dynamics.
Curr. Biol. 2009 19(1) 9-19 
[ PubMed ID = 19119011 ] [ RRC reference ]