HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Reference Feedback

Mutants under screening
Progress state

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 1514
Allele tm1514
Sequence Name F29D11.2
CGC Name capg-1
Worm Base Allele tm1514
CGC Name capg-1
Sequence F29D11.2
Phenotype lethal or sterile. Dr. B.J. Meryer: most homozygous mutants hatch but die during larval development. Dr. K. Hagstrom: maternal effect Unc, Sck, Ste, Pvl, abnormal staining in the germ cells.
Mutation site [F26A3] 866/867-[F26A3] 2381/2382 (1515 bp deletion)
Chromosome I
Putative gene structure complement(join(27036..27133, 27193..27553, 27611..27781, 28319..28499, 28560..29155, 29206..29632, 29688..29837, 29890..29910, Z78419.1:105..504, Z78419.1:552..776, Z78419.1:1120..1222, Z78419.1:1281..1451, Z78419.1:1500..1706, Z78419.1:1764..1866, Z78419.1:1908..2155))
Map position 2.21
Balancer
Map position of balancer
Sequence of primers IntRev:TACTGCCAGGATTAAGTGGT,ExtRev:CCTGTGATTGCATTACCTAG,IntFwd:CAAGAGCACCCGTTAGCCAT,ExtFwd:ATGTGTTAATCGGATCCGCT
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication