HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Technical notes
Reference Feedback

Mutants under screening
Progress state
How to propose a new target
Request form

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 1514
Allele tm1514
Sequence Name F29D11.2
CGC Name capg-1
Worm Base Allele tm1514
CGC Name capg-1
Sequence F29D11.2
Phenotype lethal or sterile. Dr. B.J. Meryer: most homozygous mutants hatch but die during larval development. Dr. K. Hagstrom: maternal effect Unc, Sck, Ste, Pvl, abnormal staining in the germ cells.
Mutation site [F26A3] 866/867-[F26A3] 2381/2382 (1515 bp deletion)
Chromosome I
Putative gene structure complement(join(27036..27133, 27193..27553, 27611..27781, 28319..28499, 28560..29155, 29206..29632, 29688..29837, 29890..29910, Z78419.1:105..504, Z78419.1:552..776, Z78419.1:1120..1222, Z78419.1:1281..1451, Z78419.1:1500..1706, Z78419.1:1764..1866, Z78419.1:1908..2155))
Map position 2.21
Balancer
Map position of balancer
Sequence of primers IntRev:TACTGCCAGGATTAAGTGGT,ExtRev:CCTGTGATTGCATTACCTAG,IntFwd:CAAGAGCACCCGTTAGCCAT,ExtFwd:ATGTGTTAATCGGATCCGCT
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication
Mets DG, Meyer BJ.
Condensins regulate meiotic DNA break distribution, thus crossover frequency, by controlling chromosome structure.
Cell 2009 139(1) 73-86 
[ PubMed ID = 19781752 ] [ RRC reference ]

Csankovszki G, Collette K, Spahl K, Carey J, Snyder M, Petty E, Patel U, Tabuchi T, Liu H, McLeod I, Thompson J, Sarkeshik A, Yates J, Meyer BJ, Hagstrom K.
Three distinct condensin complexes control C. elegans chromosome dynamics.
Curr. Biol. 2009 19(1) 9-19 
[ PubMed ID = 19119011 ] [ RRC reference ]