HOME MUTANTS PROMOTER SEARCH FAQ & CONTACT  
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Technical notes
Reference Feedback

Mutants under screening
Progress state
How to propose a new target
Request form

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 1422
Allele tm1422
Sequence Name B0410.2
CGC Name vang-1
Worm Base Allele tm1422
CGC Name vang-1
Sequence B0410.2
Phenotype homozygous viable. Dr. A. Colavita: ectopic VC axons. Dr. G. Garriga: no obvious HSN or Q neuroblast migration defects. Dr. H. Sawa: no Psa phenotype. Dr. C. Yang: normal cell death phenotype.
Mutation site 1420/1421-2016/2017 (596 bp deletion)
Chromosome X
Putative gene structure join(416..571, 1384..1517, 1568..1700, 1753..1971, 2739..3181, 3526..3744, 3796..3964, 4720..4845)
Map position -12.68
Balancer
Map position of balancer
Sequence of primers ExtFwd:GCTCTGGGTACCAATATGTG,IntFwd:GCCAGTAGGTAACCAATTCA,ExtRev:GCCAGCGCCAATGTTCAATG,IntRev:GTCTGGATCGCGAACAATAG
Distributed lab
Depositor Dr. S. Mitani/NBRP
References  Please submit your publication
Carr D, Sanchez-Alvarez L, Imai JH, Slatculescu C, Noblett N, Mao L, Beese L, Colavita A.
A Farnesyltransferase Acts to Inhibit Ectopic Neurite Formation in C. elegans.
PLoS ONE 2016 11(6) e0157537 
[ PubMed ID = 27300162 ] [ RRC reference ]

Chien SC, Gurling M, Kim C, Craft T, Forrester W, Garriga G.
Autonomous and nonautonomous regulation of Wnt-mediated neuronal polarity by the C. elegans Ror kinase CAM-1.
Dev. Biol. 2015 404(1) 55-65 
[ PubMed ID = 25917219 ] [ RRC reference ]

Mentink RA, Middelkoop TC, Rella L, Ji N, Tang CY, Betist MC, van Oudenaarden A, Korswagen HC.
Cell intrinsic modulation of Wnt signaling controls neuroblast migration in C. elegans.
Dev. Cell 2014 31(2) 188-201 
[ PubMed ID = 25373777 ] [ RRC reference ]

Kulkarni G, Xu Z, Mohamed AM, Li H, Tang X, Limerick G, Wadsworth WG.
Experimental evidence for UNC-6 (netrin) axon guidance by stochastic fluctuations of intracellular UNC-40 (DCC) outgrowth activity.
Biol Open 2013 2(12) 1300-12 
[ PubMed ID = 24337114 ] [ RRC reference ]

Honnen SJ, Büchter C, Schröder V, Hoffmann M, Kohara Y, Kampkötter A, Bossinger O.
C. elegans VANG-1 modulates life span via insulin/IGF-1-like signaling.
PLoS ONE 2012 7(2) e32183 
[ PubMed ID = 22359667 ] [ RRC reference ]

Yamamoto Y, Takeshita H, Sawa H.
Multiple Wnts redundantly control polarity orientation in Caenorhabditis elegans epithelial stem cells.
PLoS Genet. 2011 7(10) e1002308 
[ PubMed ID = 22022276 ] [ RRC reference ]

Sanchez-Alvarez L, Visanuvimol J, McEwan A, Su A, Imai JH, Colavita A.
VANG-1 and PRKL-1 cooperate to negatively regulate neurite formation in Caenorhabditis elegans.
PLoS Genet. 2011 7(9) e1002257 
[ PubMed ID = 21912529 ] [ RRC reference ]

Steimel A, Wong L, Najarro EH, Ackley BD, Garriga G, Hutter H.
The Flamingo ortholog FMI-1 controls pioneer-dependent navigation of follower axons in C. elegans.
Development 2010 137(21) 3663-73 
[ PubMed ID = 20876647 ] [ RRC reference ]

Hoffmann M, Segbert C, Helbig G, Bossinger O.
Intestinal tube formation in Caenorhabditis elegans requires vang-1 and egl-15 signaling.
Dev. Biol. 2010 339(2) 268-79 
[ PubMed ID = 20004187 ] [ RRC reference ]