HOME MUTANTS PROMOTER SEARCH FAQ & CONTACT  
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Technical notes
Reference Feedback

Mutants under screening
Progress state
How to propose a new target
Request form

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 1346
Allele tm1346
Sequence Name C49G7.11
CGC Name djr-1.2
Worm Base Allele tm1346
CGC Name djr-1.2
Sequence C49G7.11
Phenotype homozygous viable
Mutation site 26644/26645-TTGTACTTCATTATCGAAAAATACTTCAATTATCGAAAATACTTCAATTATCGAAAAAATGATTCCCAGCGATGCAAAGATTATGACCATTTTTTTATACGTTCCGACGACATTTTCGACAAAGAACACGGTCAAATAAATGATGAAGAAGTTTGCTAGAAAACTTGCACAAAAGCCGATTTTGGAGAAAATGTTAGCCAAAACCAATGACGCTACCATTTTTGATATATGTGTTCACGTTAAACAGTAATATAGTTTTTTGGGGTATGTATTATATACGTGTTGCTACATACGAAAAACAGGAAATTACAACAGAGATGCGTATTTTCCTCGAGAAAACAGTGTCTGTTCTTATTCGTTTATATTACTTTTCCTGT-27679/27680 (1035 bp deletion + 378 bp insertion)
Chromosome V
Putative gene structure complement(join(26442..26599, 26701..26971, 27229..27360))
Map position -6.77
Balancer
Map position of balancer
Sequence of primers ExtFwd:GGTCCCTCCAGTGTTTCGAC,ExtRev:TCACCGAATACCGAGCGTCA,IntFwd:GTCGCTGATAACAACGTTGT,IntRev:ATGGAGGATCTTTGGTGCGT
Distributed lab
Depositor Dr. S. Mitani
References  Please submit your publication
Chen P, DeWitt MR, Bornhorst J, Soares FA, Mukhopadhyay S, Bowman AB, Aschner M.
Age- and manganese-dependent modulation of dopaminergic phenotypes in a C. elegans DJ-1 genetic model of Parkinson's disease.
Metallomics 2015 7(2) 289-98 
[ PubMed ID = 25531510 ] [ RRC reference ]

Lee JY, Kim C, Kim J, Park C.
DJR-1.2 of Caenorhabditis elegans is induced by DAF-16 in the dauer state.
Gene 2013 524(2) 373-6 
[ PubMed ID = 23624124 ] [ RRC reference ]

Lee JY, Song J, Kwon K, Jang S, Kim C, Baek K, Kim J, Park C.
Human DJ-1 and its homologs are novel glyoxalases.
Hum. Mol. Genet. 2012 21(14) 3215-25 
[ PubMed ID = 22523093 ] [ RRC reference ]

Cornejo Castro EM, Waak J, Weber SS, Fiesel FC, Oberhettinger P, Schütz M, Autenrieth IB, Springer W, Kahle PJ.
Parkinson's disease-associated DJ-1 modulates innate immunity signaling in Caenorhabditis elegans.
J Neural Transm (Vienna) 2010 117(5) 599-604 
[ PubMed ID = 20376509 ] [ RRC reference ]