HOME MUTANTS CRE TRANSGENIC BALANCER PROMOTER SEARCH FAQ & CONTACT
The questionnaire results can be view here.     MUTANTS
KeywordSearch
Available mutants(Isolated)
Mutants under screening
  

Available mutants(Isolated)
List of all mutants
Field search
How to receive a mutant
MTA
Reference Feedback

Mutants under screening
Progress state

Feedback
Call for feedback
 
 
 

Last Update
null

 
staff only
AVAILABLE MUTANTS (ISOLATED)
 Mutant To Japanese >>
 
Record No. 1346
Allele tm1346
Sequence Name C49G7.11
CGC Name djr-1.2
Worm Base Allele tm1346
CGC Name djr-1.2
Sequence C49G7.11
Phenotype homozygous viable
Mutation site 26644/26645-TTGTACTTCATTATCGAAAAATACTTCAATTATCGAAAATACTTCAATTATCGAAAAAATGATTCCCAGCGATGCAAAGATTATGACCATTTTTTTATACGTTCCGACGACATTTTCGACAAAGAACACGGTCAAATAAATGATGAAGAAGTTTGCTAGAAAACTTGCACAAAAGCCGATTTTGGAGAAAATGTTAGCCAAAACCAATGACGCTACCATTTTTGATATATGTGTTCACGTTAAACAGTAATATAGTTTTTTGGGGTATGTATTATATACGTGTTGCTACATACGAAAAACAGGAAATTACAACAGAGATGCGTATTTTCCTCGAGAAAACAGTGTCTGTTCTTATTCGTTTATATTACTTTTCCTGT-27679/27680 (1035 bp deletion + 378 bp insertion)
Chromosome V
Putative gene structure complement(join(26442..26599, 26701..26971, 27229..27360))
Map position -6.77
Balancer
Map position of balancer
Sequence of primers ExtFwd:GGTCCCTCCAGTGTTTCGAC,ExtRev:TCACCGAATACCGAGCGTCA,IntFwd:GTCGCTGATAACAACGTTGT,IntRev:ATGGAGGATCTTTGGTGCGT
Distributed lab
Depositor Dr. S. Mitani
References  Please submit your publication
Cooper JF, Machiela E, Dues DJ, Spielbauer KK, Senchuk MM, Van Raamsdonk JM.
Activation of the mitochondrial unfolded protein response promotes longevity and dopamine neuron survival in Parkinson's disease models.
Sci Rep 2017 7(1) 16441 
[ PubMed ID = 29180793 ] [ RRC reference ]

Chen P, DeWitt MR, Bornhorst J, Soares FA, Mukhopadhyay S, Bowman AB, Aschner M.
Age- and manganese-dependent modulation of dopaminergic phenotypes in a C. elegans DJ-1 genetic model of Parkinson's disease.
Metallomics 2014 7(2) 289-98 
[ PubMed ID = 25531510 ] [ RRC reference ]

Lee JY, Kim C, Kim J, Park C.
DJR-1.2 of Caenorhabditis elegans is induced by DAF-16 in the dauer state.
Gene 2013 524(2) 373-6 
[ PubMed ID = 23624124 ] [ RRC reference ]

Lee JY, Song J, Kwon K, Jang S, Kim C, Baek K, Kim J, Park C.
Human DJ-1 and its homologs are novel glyoxalases.
Hum. Mol. Genet. 2012 21(14) 3215-25 
[ PubMed ID = 22523093 ] [ RRC reference ]

Lee JY, Song J, Kwon K, Jang S, Kim C, Baek K, Kim J, Park C.
Human DJ-1 and its homologs are novel glyoxalases.
Hum. Mol. Genet. 2012 21(14) 3215-25 
[ PubMed ID = 22523093 ] [ RRC reference ]

Cornejo Castro EM, Waak J, Weber SS, Fiesel FC, Oberhettinger P, Schütz M, Autenrieth IB, Springer W, Kahle PJ.
Parkinson's disease-associated DJ-1 modulates innate immunity signaling in Caenorhabditis elegans.
J Neural Transm (Vienna) 2010 117(5) 599-604 
[ PubMed ID = 20376509 ] [ RRC reference ]