| Allele Name | tm965 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T07C4.11 |
| Gene Name | jmjd-4 |
| Worm Base | Allele Name |
tm965
|
| Gene Name |
jmjd-4
|
| Sequence |
T07C4.11
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. M. Han: fertile, wild-type growth and normal vulval development. Dr. S. Yanase: normal lifespan on 20C. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 9363/9364-9913/9914 (550 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(7436..7596, 8071..8344, 8403..8524, 8790..8994, 9045..9294, 9344..9481, 9534..9654, 9701..9884)) |
| Map position | 2.32 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:CGATGAAACTACGTCGGAAT,ExtFwd:TTCGCTGACCAGCTATGCGA,ExtRev:GTTGCACTCCACACGGCAAT,IntRev:GGTGCTCCAAACCATTCCAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristizábal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colaiácovo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26
[ PubMed ID = 24685137 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.