分離済み変異体

tm920

Allele Nametm920
BalanceNot Required
OutCrossNot Accepted
Sequence NameF53H8.1
Gene Nameapm-3
Worm BaseAllele Name tm920
Gene Name apm-3
Sequence F53H8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Barr: PKD-2::GFP localization=WT. Dr. G. Hermann: loss of gut granules (Glo). Dr. Y. Jin: no specific neuronal phenotype is found. Dr. O. Blacque: dye-filling normal.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18182/18183-18906/18907 (724 bp deletion)
ChromosomeX
Putative gene structurejoin(17230..17264, 17324..17402, 17461..17566, 17633..17745, 17793..18074, 18513..18626, 18671..18744, 18796..18898, 19757..19849)
Map position-18.89
Balancer
Map position of balancer
Sequence of primersExtFwd:TATAGTAGTGGACCTCTCCT,IntFwd:CTCCTCTTCACGCATTTGAC,IntRev:CGTGACTCGCCACCAAATTG,ExtRev:GTCGAACGCGATTCTTCCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Morris C, Foster OK, Handa S, Peloza K, Voss L, Somhegyi H, Jian Y, Vo MV, Harp M, Rambo FM, Yang C, Hermann GJ.
Function and regulation of the Caenorhabditis elegans Rab32 family member GLO-1 in lysosome-related organelle biogenesis.
PLoS Genet 2018 14(11) e1007772 
[ PubMed ID = 30419011 ] [ RRC reference ]

Zhang S, Fan Z, Qiao P, Zhao Y, Wang Y, Jiang D, Wang X, Zhu X, Zhang Y, Huang B, Lu J, Li X.
miR-51 regulates GABAergic synapses by targeting Rab GEF GLO-4 and lysosomal trafficking-related GLO/AP-3 pathway in Caenorhabditis elegans.
Dev Biol 2018 436(1) 66-74 
[ PubMed ID = 29476722 ] [ RRC reference ]

Barrett A, Hermann GJ.
A Caenorhabditis elegans Homologue of LYST Functions in Endosome and Lysosome-Related Organelle Biogenesis.
Traffic 2016 17(5) 515-35 
[ PubMed ID = 26822177 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol Biol Cell 2014 25(7) 1073-96 
[ PubMed ID = 24501423 ] [ RRC reference ]

Hermann GJ, Scavarda E, Weis AM, Saxton DS, Thomas LL, Salesky R, Somhegyi H, Curtin TP, Barrett A, Foster OK, Vine A, Erlich K, Kwan E, Rabbitts BM, Warren K.
C. elegans BLOC-1 functions in trafficking to lysosome-related gut granules.
PLoS One 2012 7(8) e43043 
[ PubMed ID = 22916203 ] [ RRC reference ]

Gu M, Schuske K, Watanabe S, Liu Q, Baum P, Garriga G, Jorgensen EM.
Mu2 adaptin facilitates but is not essential for synaptic vesicle recycling in Caenorhabditis elegans.
J Cell Biol 2008 183(5) 881-92 
[ PubMed ID = 19047463 ] [ RRC reference ]

Rabbitts BM, Ciotti MK, Miller NE, Kramer M, Lawrenson AL, Levitte S, Kremer S, Kwan E, Weis AM, Hermann GJ.
glo-3, a novel Caenorhabditis elegans gene, is required for lysosome-related organelle biogenesis.
Genetics 2008 180(2) 857-71 
[ PubMed ID = 18780725 ] [ RRC reference ]

Currie E, King B, Lawrenson AL, Schroeder LK, Kershner AM, Hermann GJ.
Role of the Caenorhabditis elegans multidrug resistance gene, mrp-4, in gut granule differentiation.
Genetics 2007 177(3) 1569-82 
[ PubMed ID = 17947407 ] [ RRC reference ]

Grill B, Bienvenut WV, Brown HM, Ackley BD, Quadroni M, Jin Y.
C. elegans RPM-1 regulates axon termination and synaptogenesis through the Rab GEF GLO-4 and the Rab GTPase GLO-1.
Neuron 2007 55(4) 587-601 
[ PubMed ID = 17698012 ] [ RRC reference ]

Schroeder LK, Kremer S, Kramer MJ, Currie E, Kwan E, Watts JL, Lawrenson AL, Hermann GJ.
Function of the Caenorhabditis elegans ABC transporter PGP-2 in the biogenesis of a lysosome-related fat storage organelle.
Mol Biol Cell 2007 18(3) 995-1008 
[ PubMed ID = 17202409 ] [ RRC reference ]

Bae YK, Qin H, Knobel KM, Hu J, Rosenbaum JL, Barr MM.
General and cell-type specific mechanisms target TRPP2/PKD-2 to cilia.
Development 2006 133(19) 3859-70 
[ PubMed ID = 16943275 ] [ RRC reference ]

Hermann GJ, Schroeder LK, Hieb CA, Kershner AM, Rabbitts BM, Fonarev P, Grant BD, Priess JR.
Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.
Mol Biol Cell 2005 16(7) 3273-88 
[ PubMed ID = 15843430 ] [ RRC reference ]