分離済み変異体

tm903

Allele Nametm903
BalanceNot Required
OutCrossNot Accepted
Sequence NameT23G5.5
Gene Namedat-1
Worm BaseAllele Name tm903
Gene Name dat-1
Sequence T23G5.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Jansen: WT avoidance of 0.5 M NaCl and WT chemotaxis to NaCl. Dr. L. Avery: Feeding and satiety behavior normal.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24428/24429-24968/24969 (540 bp deletion)
ChromosomeIII
Putative gene structurejoin(23832..23850, 24227..24345, 24394..24713, 25029..25178, 25230..25323, 25373..25567, 25612..25724, 25772..26009, 26052..26180, 26225..26324, 26366..26466, 26724..26894, Z19156.1:464..562)
Map position0.36
Balancer
Map position of balancer
Sequence of primersExtRev:GCTCCAGCAAAACTTCCAAT,IntRev:GCGGAATCCCATCATCTCTT,ExtFwd:AAATCGGTCGGACGTCTAAT,IntFwd:GGCATGCAAAATGCAACTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Petratou D, Gjikolaj M, Kaulich E, Schafer W, Tavernarakis N.
A proton-inhibited DEG/ENaC ion channel maintains neuronal ionstasis and promotes neuronal survival under stress.
iScience 2023 26(7) 107117 
[ PubMed ID = 37416472 ] [ RRC reference ]

Hartman JH, Richie CT, Gordon KL, Mello DF, Castillo P, Zhu A, Wang Y, Hoffer BJ, Sherwood DR, Meyer JN, Harvey BK.
MANF deletion abrogates early larval Caenorhabditis elegans stress response to tunicamycin and Pseudomonas aeruginosa.
Eur J Cell Biol 2019 98(5-8) 151043 
[ PubMed ID = 31138438 ] [ RRC reference ]

Ward A, Walker VJ, Feng Z, Xu XZ.
Cocaine modulates locomotion behavior in C. elegans.
PLoS One 2009 4(6) e5946 
[ PubMed ID = 19536276 ] [ RRC reference ]

Wang J, Farr GW, Hall DH, Li F, Furtak K, Dreier L, Horwich AL.
An ALS-linked mutant SOD1 produces a locomotor defect associated with aggregation and synaptic dysfunction when expressed in neurons of Caenorhabditis elegans.
PLoS Genet 2009 5(1) e1000350 
[ PubMed ID = 19165329 ] [ RRC reference ]

Voglis G, Tavernarakis N.
A synaptic DEG/ENaC ion channel mediates learning in C. elegans by facilitating dopamine signalling.
EMBO J 2008 27(24) 3288-99 
[ PubMed ID = 19037257 ] [ RRC reference ]

Hukema RK, Rademakers S, Jansen G.
Gustatory plasticity in C. elegans involves integration of negative cues and NaCl taste mediated by serotonin, dopamine, and glutamate.
Learn Mem 2008 15(11) 829-36 
[ PubMed ID = 18984564 ] [ RRC reference ]

You YJ, Kim J, Raizen DM, Avery L.
Insulin, cGMP, and TGF-beta signals regulate food intake and quiescence in C. elegans: a model for satiety.
Cell Metab 2008 7(3) 249-57 
[ PubMed ID = 18316030 ] [ RRC reference ]

Wragg RT, Hapiak V, Miller SB, Harris GP, Gray J, Komuniecki PR, Komuniecki RW.
Tyramine and octopamine independently inhibit serotonin-stimulated aversive behaviors in Caenorhabditis elegans through two novel amine receptors.
J Neurosci 2007 27(49) 13402-12 
[ PubMed ID = 18057198 ] [ RRC reference ]