分離済み変異体

tm899

Allele Nametm899
BalanceNot Required
OutCrossNot Accepted
Sequence NameDY3.4
Gene Nametrt-1
Worm BaseAllele Name tm899
Gene Name trt-1
Sequence DY3.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Ahmed: ProS Genetics 2, e18 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11221/11222-12370/12371 (1149 bp deletion)
ChromosomeI
Putative gene structurejoin(10193..10324, 10410..10594, 10643..10815, 10872..11128, 11371..11539, 11581..11734, 11780..11936, 12271..12528, 12606..12671, 12719..12853)
Map position3.09
Balancer
Map position of balancer
Sequence of primersExtRev:AAATTGACGAGCCACACCGT,IntFwd:GCGCAACATCTAAAGCACAT,ExtFwd:ACGTAGTGGGATTAGTAGCA,IntRev:GTCTTTGCATCTTCGTCGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bailly AP, Freeman A, Hall J, Déclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A.
The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.
PLoS Genet 2010 6(7) e1001025 
[ PubMed ID = 20661466 ] [ RRC reference ]

Meier B, Barber LJ, Liu Y, Shtessel L, Boulton SJ, Gartner A, Ahmed S.
The MRT-1 nuclease is required for DNA crosslink repair and telomerase activity in vivo in Caenorhabditis elegans.
EMBO J 2009 28(22) 3549-63 
[ PubMed ID = 19779462 ] [ RRC reference ]

Meier B, Clejan I, Liu Y, Lowden M, Gartner A, Hodgkin J, Ahmed S.
trt-1 is the Caenorhabditis elegans catalytic subunit of telomerase.
PLoS Genet 2006 2(2) e18 
[ PubMed ID = 16477310 ] [ RRC reference ]