分離済み変異体

tm892

Allele Nametm892
BalanceCompleted
OutCrossNot Accepted
Sequence NameF20D12.1
Gene Namecsr-1
Worm BaseAllele Name tm892 (x1)
Gene Name csr-1
Sequence F20D12.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26731/26372-27131/27132 (400 bp deletion)
ChromosomeIV
Putative gene structurejoin(25568..26042, 26587..26746, 26788..26941, 26985..27196, 27241..27392, 27440..27825, 27871..28592, 28637..28736, 28781..29137, 29188..29376, 29420..29508, 29555..29651)
Map position3.52
Balancerunc-24 (e138) IV
Map position of balancer
Sequence of primersExtRev:CGCAGCGTTTCGGTCAGGAT,IntFwd:GCCCTGAACATCTTCGGGCT,ExtFwd:GGCCTTTCTCTGCGTTTAGT,IntRev:TCAGGATGAGCAACGTCCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799 
[ PubMed ID = 38987544 ] [ RRC reference ]

Waddell BM, Wu CW.
A role for the C. elegans Argonaute protein CSR-1 in small nuclear RNA 3' processing.
PLoS Genet 2024 20(5) e1011284 
[ PubMed ID = 38743783 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Cornes E, Bourdon L, Singh M, Mueller F, Quarato P, Wernersson E, Bienko M, Li B, Cecere G.
piRNAs initiate transcriptional silencing of spermatogenic genes during C. elegans germline development.
Dev Cell 2022 57(2) 180-196.e7 
[ PubMed ID = 34921763 ] [ RRC reference ]

Charlesworth AG, Seroussi U, Lehrbach NJ, Renaud MS, Sundby AE, Molnar RI, Lao RX, Willis AR, Woock JR, Aber MJ, Diao AJ, Reinke AW, Ruvkun G, Claycomb JM.
Two isoforms of the essential C. elegans Argonaute CSR-1 differentially regulate sperm and oocyte fertility.
Nucleic Acids Res 2021 49(15) 8836-8865 
[ PubMed ID = 34329465 ] [ RRC reference ]

Quarato P, Singh M, Cornes E, Li B, Bourdon L, Mueller F, Didier C, Cecere G.
Germline inherited small RNAs facilitate the clearance of untranslated maternal mRNAs in C. elegans embryos.
Nat Commun 2021 12(1) 1441 
[ PubMed ID = 33664268 ] [ RRC reference ]

Mutlu B, Chen HM, Gutnik S, Hall DH, Keppler-Ross S, Mango SE.
Distinct functions and temporal regulation of methylated histone H3 during early embryogenesis.
Development 2019 146(19)  
[ PubMed ID = 31540912 ] [ RRC reference ]

Ouyang JPT, Folkmann A, Bernard L, Lee CY, Seroussi U, Charlesworth AG, Claycomb JM, Seydoux G.
P Granules Protect RNA Interference Genes from Silencing by piRNAs.
Dev Cell 2019 50(6) 716-728.e6 
[ PubMed ID = 31402283 ] [ RRC reference ]

Gushchanskaia ES, Esse R, Ma Q, Lau NC, Grishok A.
Interplay between small RNA pathways shapes chromatin landscapes in C. elegans.
Nucleic Acids Res 2019 47(11) 5603-5616 
[ PubMed ID = 31216042 ] [ RRC reference ]

Yang B, Xu X, Russell L, Sullenberger MT, Yanowitz JL, Maine EM.
A DNA repair protein and histone methyltransferase interact to promote genome stability in the Caenorhabditis elegans germ line.
PLoS Genet 2019 15(2) e1007992 
[ PubMed ID = 30794539 ] [ RRC reference ]

Davis GM, Tu S, Anderson JW, Colson RN, Gunzburg MJ, Francisco MA, Ray D, Shrubsole SP, Sobotka JA, Seroussi U, Lao RX, Maity T, Wu MZ, McJunkin K, Morris QD, Hughes TR, Wilce JA, Claycomb JM, Weng Z, Boag PR.
The TRIM-NHL protein NHL-2 is a co-factor in the nuclear and somatic RNAi pathways in C. elegans.
Elife 2018 7  
[ PubMed ID = 30575518 ] [ RRC reference ]

Ishidate T, Ozturk AR, Durning DJ, Sharma R, Shen EZ, Chen H, Seth M, Shirayama M, Mello CC.
ZNFX-1 Functions within Perinuclear Nuage to Balance Epigenetic Signals.
Mol Cell 2018 70(4) 639-649.e6 
[ PubMed ID = 29775580 ] [ RRC reference ]

Fassnacht C, Tocchini C, Kumari P, Gaidatzis D, Stadler MB, Ciosk R.
The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans.
PLoS Genet 2018 14(3) e1007252 
[ PubMed ID = 29579041 ] [ RRC reference ]

Ow MC, Borziak K, Nichitean AM, Dorus S, Hall SE.
Early experiences mediate distinct adult gene expression and reproductive programs in Caenorhabditis elegans.
PLoS Genet 2018 14(2) e1007219 
[ PubMed ID = 29447162 ] [ RRC reference ]

Tyc KM, Nabih A, Wu MZ, Wedeles CJ, Sobotka JA, Claycomb JM.
The Conserved Intron Binding Protein EMB-4 Plays Differential Roles in Germline Small RNA Pathways of C. elegans.
Dev Cell 2017 42(3) 256-270.e6 
[ PubMed ID = 28787592 ] [ RRC reference ]

Bharadwaj PS, Hall SE.
Endogenous RNAi Pathways Are Required in Neurons for Dauer Formation in Caenorhabditis elegans.
Genetics 2017 205(4) 1503-1516 
[ PubMed ID = 28122825 ] [ RRC reference ]

Gerson-Gurwitz A, Wang S, Sathe S, Green R, Yeo GW, Oegema K, Desai A.
A Small RNA-Catalytic Argonaute Pathway Tunes Germline Transcript Levels to Ensure Embryonic Divisions.
Cell 2016 165(2) 396-409 
[ PubMed ID = 27020753 ] [ RRC reference ]

Tu S, Wu MZ, Wang J, Cutter AD, Weng Z, Claycomb JM.
Comparative functional characterization of the CSR-1 22G-RNA pathway in Caenorhabditis nematodes.
Nucleic Acids Res 2015 43(1) 208-24 
[ PubMed ID = 25510497 ] [ RRC reference ]

Barberán-Soler S, Fontrodona L, Ribó A, Lamm AT, Iannone C, Cerón J, Lehner B, Valcárcel J.
Co-option of the piRNA pathway for germline-specific alternative splicing of C. elegans TOR.
Cell Rep 2014 8(6) 1609-1616 
[ PubMed ID = 25220461 ] [ RRC reference ]

Kennedy LM, Grishok A.
Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.
Genetics 2014 197(1) 207-20 
[ PubMed ID = 24558261 ] [ RRC reference ]