分離済み変異体

tm872

Allele Nametm872
BalanceNot Required
OutCrossNot Accepted
Sequence NameD2030.6
Gene Nameprg-1
Worm BaseAllele Name tm872
Gene Name prg-1
Sequence D2030.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21432/21433-22072/22073 (640 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(20481..20636, 20682..20868, 20915..21152, 21201..21375, 21423..21787, 21834..22275, 22320..22562, 22611..22925, 22975..23328))
Map position2.18
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:CTGTAGAGGATCAAGCGGCT,IntFwd:AGTCGTGGTACAGATCGTAG,ExtRev:GGGATATCTCGCAACGACTA,IntRev:GAGAGGCCGTGGTTCAGGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Pastore B, Hertz HL, Tang W.
The ribonuclease DISL-2 mediates piRNA degradation in C. elegans.
Cell Rep 2025 44(10) 116430 
[ PubMed ID = 41075248 ] [ RRC reference ]

Heestand B, McCarthy B, Simon M, Lister-Shimauchi EH, Frenk S, Ahmed S.
Piwi mutant germ cells transmit a form of heritable stress that promotes longevity.
Aging Cell 2025 24(1) e14350 
[ PubMed ID = 39520150 ] [ RRC reference ]

Eroglu M, Zocher T, McAuley J, Webster R, Xiao MZX, Yu B, Mok C, Derry WB.
Noncanonical inheritance of phenotypic information by protein amyloids.
Nat Cell Biol 2024 26(10) 1712-1724 
[ PubMed ID = 39223373 ] [ RRC reference ]

Pastore B, Hertz HL, Tang W.
Pre-piRNA trimming safeguards piRNAs against erroneous targeting by RNA-dependent RNA polymerase.
Cell Rep 2024 43(2) 113692 
[ PubMed ID = 38244197 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Ow MC, Nishiguchi MA, Dar AR, Butcher RA, Hall SE.
RNAi-dependent expression of sperm genes in ADL chemosensory neurons is required for olfactory responses in Caenorhabditis elegans.
Front Mol Biosci 2024 11 1396587 
[ PubMed ID = 39055986 ] [ RRC reference ]

Huang X, Wang C, Zhang T, Li R, Chen L, Leung KL, Lakso M, Zhou Q, Zhang H, Wong G.
PIWI-interacting RNA expression regulates pathogenesis in a Caenorhabditis elegans model of Lewy body disease.
Nat Commun 2023 14(1) 6137 
[ PubMed ID = 37783675 ] [ RRC reference ]

Dai S, Tang X, Li L, Ishidate T, Ozturk AR, Chen H, Dude AL, Yan YH, Dong MQ, Shen EZ, Mello CC.
A family of C. elegans VASA homologs control Argonaute pathway specificity and promote transgenerational silencing.
Cell Rep 2022 40(10) 111265 
[ PubMed ID = 36070689 ] [ RRC reference ]

Pastore B, Hertz HL, Tang W.
Comparative analysis of piRNA sequences, targets and functions in nematodes.
RNA Biol 2022 19(1) 1276-1292 
[ PubMed ID = 36412988 ] [ RRC reference ]

Montgomery BE, Vijayasarathy T, Marks TN, Cialek CA, Reed KJ, Montgomery TA.
Dual roles for piRNAs in promoting and preventing gene silencing in C. elegans.
Cell Rep 2021 37(10) 110101 
[ PubMed ID = 34879267 ] [ RRC reference ]

Shukla A, Perales R, Kennedy S.
piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.
Curr Biol 2021 31(20) 4473-4485.e3 
[ PubMed ID = 34428467 ] [ RRC reference ]

Makeyeva YV, Shirayama M, Mello CC.
Cues from mRNA splicing prevent default Argonaute silencing in C. elegans.
Dev Cell 2021 56(18) 2636-2648.e4 
[ PubMed ID = 34547227 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10  
[ PubMed ID = 34236316 ] [ RRC reference ]

Kim H, Ding YH, Zhang G, Yan YH, Conte D Jr, Dong MQ, Mello CC.
HDAC1 SUMOylation promotes Argonaute-directed transcriptional silencing in C. elegans.
Elife 2021 10  
[ PubMed ID = 34003109 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420 
[ PubMed ID = 33658512 ] [ RRC reference ]

Ishidate T, Ozturk AR, Durning DJ, Sharma R, Shen EZ, Chen H, Seth M, Shirayama M, Mello CC.
ZNFX-1 Functions within Perinuclear Nuage to Balance Epigenetic Signals.
Mol Cell 2018 70(4) 639-649.e6 
[ PubMed ID = 29775580 ] [ RRC reference ]

Heestand B, Simon M, Frenk S, Titov D, Ahmed S.
Transgenerational Sterility of Piwi Mutants Represents a Dynamic Form of Adult Reproductive Diapause.
Cell Rep 2018 23(1) 156-171 
[ PubMed ID = 29617657 ] [ RRC reference ]

Tang W, Seth M, Tu S, Shen EZ, Li Q, Shirayama M, Weng Z, Mello CC.
A Sex Chromosome piRNA Promotes Robust Dosage Compensation and Sex Determination in C. elegans.
Dev Cell 2018 44(6) 762-770.e3 
[ PubMed ID = 29456136 ] [ RRC reference ]

Seth M, Shirayama M, Tang W, Shen EZ, Tu S, Lee HC, Weng Z, Mello CC.
The Coding Regions of Germline mRNAs Confer Sensitivity to Argonaute Regulation in C. elegans.
Cell Rep 2018 22(9) 2254-2264 
[ PubMed ID = 29456100 ] [ RRC reference ]

Shen EZ, Chen H, Ozturk AR, Tu S, Shirayama M, Tang W, Ding YH, Dai SY, Weng Z, Mello CC.
Identification of piRNA Binding Sites Reveals the Argonaute Regulatory Landscape of the C. elegans Germline.
Cell 2018 172(5) 937-951.e18 
[ PubMed ID = 29456082 ] [ RRC reference ]