Allele Name | tm866 |
Allele Type | 通常株 |
Sequence Name | C42D8.4 |
Gene Name | ets-5 |
Worm Base | Allele Name |
tm866
|
Gene Name |
ets-5
|
Sequence |
C42D8.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. O. Hobert: no effect on dat-1::gfp expression. Nature. 2009 458:885. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 429/430-1731/1732 (1302 bp deletion) |
Chromosome | X |
Putative gene structure | complement(join(830..895, 943..1052, 1105..1243, 2314..2386, 2436..2674)) |
Map position | -6.2 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:GCGAGTGTATTTAGACTCAG,ExtRev:GGGGTAAGCCTATCATAGTT,ExtFwd:CGCTGCAAATCGGACTAAAA,IntFwd:CATGCAGCCTAGTATTTTCC |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Taylor M, Marx O, Norris A. TDP-1 and FUST-1 co-inhibit exon inclusion and control fertility together with transcriptional regulation. Nucleic Acids Res 2023 51(18) 9610-9628
[ PubMed ID = 37587694 ]
[ RRC reference ]
|
Godini R, Pocock R. Characterization of the Doublesex/MAB-3 transcription factor DMD-9 in Caenorhabditis elegans. G3 (Bethesda) 2023 13(2)
[ PubMed ID = 36454093 ]
[ RRC reference ]
|
McCulloch KA, Zhou K, Jin Y. Neuronal transcriptome analyses reveal novel neuropeptide modulators of excitation and inhibition imbalance in C. elegans. PLoS One 2020 15(6) e0233991
[ PubMed ID = 32497060 ]
[ RRC reference ]
|
Juozaityte V, Pladevall-Morera D, Podolska A, Nørgaard S, Neumann B, Pocock R. The ETS-5 transcription factor regulates activity states in Caenorhabditis elegans by controlling satiety. Proc Natl Acad Sci U S A 2017 114(9) E1651-E1658
[ PubMed ID = 28193866 ]
[ RRC reference ]
|
Guillermin ML, Castelletto ML, Hallem EA. Differentiation of carbon dioxide-sensing neurons in Caenorhabditis elegans requires the ETS-5 transcription factor. Genetics 2011 189(4) 1327-39
[ PubMed ID = 21954162 ]
[ RRC reference ]
|
Flames N, Hobert O. Gene regulatory logic of dopamine neuron differentiation. Nature 2009 458(7240) 885-9
[ PubMed ID = 19287374 ]
[ RRC reference ]
|
|