分離済み変異体

tm863

Allele Name

tm863

Balance

Not Required

OutCross

Not Accepted

Sequence Name

T09A5.3

Gene Name

acr-7

Worm Base

Allele Name

tm863

Gene Name

acr-7

Sequence

T09A5.3

Phenotype

homozygous viable. Dr. J-L. Bessereau: sensitive to nicotinic agonist DMPP after backcross.

Mutation site

16544/16545-GCTTCAG-17169/17170 (625 bp deletion + 7 bp insertion)

Chromosome

Putative gene structure

complement(join(13764..13883, 14304..14419, 16232..16358, 16404..16603, 16657..16790, 16840..16957, 17048..17171, 17220..17310, 17357..17481, 17528..17675, 17718..17821))

Map position

0.58

Balancer

Map position of balancer

Sequence of primers

IntFwd:CCCACTACGTACAGAGGTAT,ExtFwd:GATTGCATTTCAAGCCCACT,IntRev:GAGGAGTGAATGAGCATTGT,ExtRev:TGAATTGCCCTCTCGTCTAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Dong B, Chen W.
A high precision method of segmenting complex postures in Caenorhabditis elegans and deep phenotyping to analyze lifespan.
Sci Rep 2025 15(1) 8870
[ PubMed ID = 40087519 ] [ RRC reference ]

Izquierdo PG, Calahorro F, Thisainathan T, Atkins JH, Haszczyn J, Lewis CJ, Tattersall JEH, Green AC, Holden-Dye L, O'Connor V.
Cholinergic signaling at the body wall neuromuscular junction distally inhibits feeding behavior in Caenorhabditis elegans.
J Biol Chem 2022 298(1) 101466
[ PubMed ID = 34864060 ] [ RRC reference ]

Kozlova AA, Lotfi M, Okkema PG.
Cross Talk with the GAR-3 Receptor Contributes to Feeding Defects in Caenorhabditis elegans eat-2 Mutants.
Genetics 2019 212(1) 231-243
[ PubMed ID = 30898771 ] [ RRC reference ]

White CV, Herman MA.
Transcriptomic, Functional, and Network Analyses Reveal Novel Genes Involved in the Interaction Between Caenorhabditis elegans and Stenotrophomonas maltophilia.
Front Cell Infect Microbiol 2018 8 266
[ PubMed ID = 30177956 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9
[ PubMed ID = 23852451 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc Natl Acad Sci U S A 2013 110(29) 11940-5
[ PubMed ID = 23818641 ] [ RRC reference ]

Saur T, DeMarco SE, Ortiz A, Sliwoski GR, Hao L, Wang X, Cohen BM, Buttner EA.
A genome-wide RNAi screen in Caenorhabditis elegans identifies the nicotinic acetylcholine receptor subunit ACR-7 as an antipsychotic drug target.
PLoS Genet 2013 9(2) e1003313
[ PubMed ID = 23468647 ] [ RRC reference ]

Ruaud AF, Bessereau JL.
Activation of nicotinic receptors uncouples a developmental timer from the molting timer in C. elegans.
Development 2006 133(11) 2211-22
[ PubMed ID = 16672334 ] [ RRC reference ]