分離済み変異体

tm858

Allele Nametm858
BalanceNot Required
OutCrossNot Accepted
Sequence NameC06G4.2
Gene Nameclp-1
Worm BaseAllele Name tm858
Gene Name clp-1
Sequence C06G4.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Driscoll: normal brood size, development, locomotion. Dr. N. Tavernarakis: suppression of neurodegeneration, normal development, normal locomotion, normal body size/shape, normal brood size. Dr. M. Hengartner: clp-1(tm858); deg-3(u662) shows reduced vacuolization compared to deg-3(u662)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 6097/6098-TTTTTTTTTTT-6503/6504 (406 bp deletion + 11 bp insertion)
ChromosomeIII
Putative gene structurejoin(4799..4874, 5795..5923, 5971..6413, 6456..6614, 6685..6947, 7008..7139, 7514..7983, 8028..8104, 8729..8818, 8865..8987)
Map position-0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:CAATGATATCGGTGGACTCA,IntFwd:TCATCAACAGTATGGGAGGT,IntRev:GGCCTTGACACCAGTCATTT,ExtRev:CAAACCATTCCAGCGGCCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen J, Chitrakar R, Baugh LR.
DAF-18/PTEN protects LIN-35/Rb from CLP-1/CAPN-mediated cleavage to promote starvation resistance.
Life Sci Alliance 2025 8(6)  
[ PubMed ID = 40199585 ] [ RRC reference ]

Donato A, Ritchie FK, Lu L, Wadia M, Martinez-Marmol R, Kaulich E, Sankorrakul K, Lu H, Coakley S, Coulson EJ, Hilliard MA.
OSP-1 protects neurons from autophagic cell death induced by acute oxidative stress.
Nat Commun 2025 16(1) 300 
[ PubMed ID = 39746999 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Bano D, Dinsdale D, Cabrera-Socorro A, Maida S, Lambacher N, McColl B, Ferrando-May E, Hengartner MO, Nicotera P.
Alteration of the nuclear pore complex in Ca(2+)-mediated cell death.
Cell Death Differ 2010 17(1) 119-33 
[ PubMed ID = 19713973 ] [ RRC reference ]

Mano I, Driscoll M.
Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity.
J Neurochem 2009 108(6) 1373-84 
[ PubMed ID = 19054279 ] [ RRC reference ]

Samara C, Syntichaki P, Tavernarakis N.
Autophagy is required for necrotic cell death in Caenorhabditis elegans.
Cell Death Differ 2008 15(1) 105-12 
[ PubMed ID = 17901876 ] [ RRC reference ]