Allele Name | tm850 |
Allele Type | 通常株 |
Sequence Name | F59A6.1 |
Gene Name | nsy-1 |
Worm Base | Allele Name |
tm850
|
Gene Name |
nsy-1
|
Sequence |
F59A6.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| Homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 28901/28902-30098/30099 (1197 bp deletion) |
Chromosome | II |
Putative gene structure | join(27872..27925, 28652..28894, 29122..29409, 29457..29851, 29901..30019, 30459..31236, 31283..32197, 32513..33293, 33356..33946) |
Map position | -2.59 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:ATCAGTGTCTGCCTCAGTTG,ExtFwd:CTTTGCCACTACCGCCACGT,IntFwd:CATACCACGCAAGTCGAATG,IntRev:GCCTCCATGAAGAATTCACT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Sugawara T, Sakamoto K. Quercetin enhances motility in aged and heat-stressed Caenorhabditis elegans nematodes by modulating both HSF-1 activity, and insulin-like and p38-MAPK signalling. PLoS One 2020 15(9) e0238528
[ PubMed ID = 32881908 ]
[ RRC reference ]
|
Hayakawa T, Kato K, Hayakawa R, Hisamoto N, Matsumoto K, Takeda K, Ichijo H. Regulation of anoxic death in Caenorhabditis elegans by mammalian apoptosis signal-regulating kinase (ASK) family proteins. Genetics 2011 187(3) 785-92
[ PubMed ID = 21212236 ]
[ RRC reference ]
|
|