| Allele Name | tm8421 |
| Balance | Not Required |
| OutCross | Request Available |
| Sequence Name | C42D8.5 |
| Gene Name | acn-1 |
| Worm Base | Allele Name |
tm8421
|
| Gene Name |
acn-1
|
| Sequence |
C42D8.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 18182/18183-GTTTTT-18274/18275 (92 bp deletion + 6 bp insertion) |
| Chromosome | X |
| Putative gene structure | complement(join(13893..14063, 14114..14345, 14715..14944, 14993..15284, 15333..15479, 15533..15783, 15840..16341, 16401..16717, 17423..17494, 17560..17649, 17698..18117)) |
| Map position | -6.19 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GAACCGTTCTTTGGAGTGTC,ExtRev:ATCCAGTGACTGTCCACGCC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Yokoyama I, Yamane M, Watanabe K, Fatah A, Komiya Y, Nagasao J, Arihara K. ACE-inhibitory peptide Leu-Tyr-Ala in skeletal muscle actin exhibits anti-aging effects through the inhibition of acn-1 in Caenorhabditis elegans. J Sci Food Agric 2026
[ PubMed ID = 42135920 ]
[ RRC reference ]
|
Pieroni EM, O'Connor V, Holden-Dye L, Imperadore P, Fiorito G, Dillon J. Identification of molecular nociceptors in Octopus vulgaris through functional characterisation in Caenorhabditis elegans. Biol Open 2026 15(1)
[ PubMed ID = 41431869 ]
[ RRC reference ]
|
|