分離済み変異体

tm8421

Allele Nametm8421
BalanceNot Required
OutCrossRequest Available
Sequence NameC42D8.5
Gene Nameacn-1
Worm BaseAllele Name tm8421
Gene Name acn-1
Sequence C42D8.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18182/18183-GTTTTT-18274/18275 (92 bp deletion + 6 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(13893..14063, 14114..14345, 14715..14944, 14993..15284, 15333..15479, 15533..15783, 15840..16341, 16401..16717, 17423..17494, 17560..17649, 17698..18117))
Map position-6.19
Balancer
Map position of balancer
Sequence of primersExtFwd:GAACCGTTCTTTGGAGTGTC,ExtRev:ATCCAGTGACTGTCCACGCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yokoyama I, Yamane M, Watanabe K, Fatah A, Komiya Y, Nagasao J, Arihara K.
ACE-inhibitory peptide Leu-Tyr-Ala in skeletal muscle actin exhibits anti-aging effects through the inhibition of acn-1 in Caenorhabditis elegans.
J Sci Food Agric 2026   
[ PubMed ID = 42135920 ] [ RRC reference ]

Pieroni EM, O'Connor V, Holden-Dye L, Imperadore P, Fiorito G, Dillon J.
Identification of molecular nociceptors in Octopus vulgaris through functional characterisation in Caenorhabditis elegans.
Biol Open 2026 15(1)  
[ PubMed ID = 41431869 ] [ RRC reference ]