分離済み変異体

tm840

Allele Nametm840
BalanceNot Required
OutCrossNot Accepted
Sequence NameC18G1.2
Gene Nameelt-7
Worm BaseAllele Name tm840
Gene Name elt-7
Sequence C18G1.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Homozygous viable. Dr. P. Sengupta: dyf+ in all sensory neurons.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28742/28743-29358/29359 (616 bp deletion)
ChromosomeV
Putative gene structurejoin(27796..27917, 28796..29081, 29135..29220, 29866..29968)
Map position-4.22
Balancer
Map position of balancer
Sequence of primersExtRev:GGGATACGTAATATGCTGGA,IntRev:TGGCGATACAGTCCAAACTT,IntFwd:TGCATCTCTGACTTACCACT,ExtFwd:GCACACAAGGCATAGGTACA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Williams RTP, King DC, Mastroianni IR, Hill JL, Apenes NW, Ramirez G, Miner EC, Moore A, Coleman K, Nishimura EO.
Transcriptome profiling of the Caenorhabditis elegans intestine reveals that ELT-2 negatively and positively regulates intestinal gene expression within the context of a gene regulatory network.
Genetics 2023 224(4)  
[ PubMed ID = 37183501 ] [ RRC reference ]

Broitman-Maduro G, Sun S, Kikuchi T, Maduro MF.
The GATA factor ELT-3 specifies endoderm in Caenorhabditis angaria in an ancestral gene network.
Development 2022 149(21)  
[ PubMed ID = 36196618 ] [ RRC reference ]

Ewe CK, Sommermann EM, Kenchel J, Flowers SE, Maduro MF, Joshi PM, Rothman JH.
Feedforward regulatory logic controls the specification-to-differentiation transition and terminal cell fate during Caenorhabditis elegans endoderm development.
Development 2022 149(12)  
[ PubMed ID = 35758255 ] [ RRC reference ]

Zárate-Potes A, Yang W, Pees B, Schalkowski R, Segler P, Andresen B, Haase D, Nakad R, Rosenstiel P, Tetreau G, Colletier JP, Schulenburg H, Dierking K.
The C. elegans GATA transcription factor elt-2 mediates distinct transcriptional responses and opposite infection outcomes towards different Bacillus thuringiensis strains.
PLoS Pathog 2020 16(9) e1008826 
[ PubMed ID = 32970778 ] [ RRC reference ]

Lancaster BR, McGhee JD.
How affinity of the ELT-2 GATA factor binding to cis-acting regulatory sites controls Caenorhabditis elegans intestinal gene transcription.
Development 2020 147(14)  
[ PubMed ID = 32586978 ] [ RRC reference ]

Wiesenfahrt T, Duanmu J, Snider F, Moerman D, Au V, Li-Leger E, Flibotte S, Parker DM, Marshall CJ, Nishimura EO, Mains PE, McGhee JD.
A Strategy To Isolate Modifiers of Caenorhabditis elegans Lethal Mutations: Investigating the Endoderm Specifying Ability of the Intestinal Differentiation GATA Factor ELT-2.
G3 (Bethesda) 2018 8(5) 1425-1437 
[ PubMed ID = 29593072 ] [ RRC reference ]

Dineen A, Osborne Nishimura E, Goszczynski B, Rothman JH, McGhee JD.
Quantitating transcription factor redundancy: The relative roles of the ELT-2 and ELT-7 GATA factors in the C. elegans endoderm.
Dev Biol 2018 435(2) 150-161 
[ PubMed ID = 29360433 ] [ RRC reference ]

Wiesenfahrt T, Berg JY, Osborne Nishimura E, Robinson AG, Goszczynski B, Lieb JD, McGhee JD.
The function and regulation of the GATA factor ELT-2 in the C. elegans endoderm.
Development 2016 143(3) 483-91 
[ PubMed ID = 26700680 ] [ RRC reference ]

Nair G, Walton T, Murray JI, Raj A.
Gene transcription is coordinated with, but not dependent on, cell divisions during C. elegans embryonic fate specification.
Development 2013 140(16) 3385-94 
[ PubMed ID = 23863485 ] [ RRC reference ]

Sommermann EM, Strohmaier KR, Maduro MF, Rothman JH.
Endoderm development in Caenorhabditis elegans: the synergistic action of ELT-2 and -7 mediates the specification→differentiation transition.
Dev Biol 2010 347(1) 154-66 
[ PubMed ID = 20807527 ] [ RRC reference ]

McGhee JD, Sleumer MC, Bilenky M, Wong K, McKay SJ, Goszczynski B, Tian H, Krich ND, Khattra J, Holt RA, Baillie DL, Kohara Y, Marra MA, Jones SJ, Moerman DG, Robertson AG.
The ELT-2 GATA-factor and the global regulation of transcription in the C. elegans intestine.
Dev Biol 2007 302(2) 627-45 
[ PubMed ID = 17113066 ] [ RRC reference ]