Home > 分離済み変異体 > tm830

分離済み変異体

Allele Name		tm830
Balance		Not Required
OutCross		Not Accepted
Sequence Name		C47A10.1
Gene Name		pgp-9
Worm Base	Allele Name	tm830
	Gene Name	pgp-9
	Sequence	C47A10.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Homozygous viable. Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA. Dr. I. Mori: normal thermotaxis when cultured at 17&23 C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		5091/5092-5701/5702 (610 bp deletion)
Chromosome		V
Putative gene structure		join(Z93782.1:16574..16617, 2..158, 224..391, 1190..1323, 2031..3052, 4078..4499, 4549..5078, 5500..6289, 6355..6561, 8208..8481, 8526..8662)
Map position		13.19
Balancer
Map position of balancer
Sequence of primers		ExtFwd:TGTGCAATCGGCTCTGGAGA,IntRev:AAGTGTCTGCCCGGGCTTCA,IntFwd:GGGCGTACCACAATTGTGAT,ExtRev:CAACCACTAGGTCCCACCAA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Hellinga JR, Krücken J, Schulenburg H, von Samson-Himmelstjerna G. Use of Viscous medium to study anthelmintic drug action in Caenorhabditis elegans. Sci Rep 2024 14(1) 12756  [ PubMed ID = 38830930 ] [ RRC reference ] Okahata M, Sawada N, Nakao K, Ohta A, Kuhara A. Screening for cold tolerance genes in C. elegans, whose expressions are affected by anticancer drugs camptothecin and leptomycin B. Sci Rep 2024 14(1) 5401  [ PubMed ID = 38443452 ] [ RRC reference ] Earley BJ, Cubillas C, Warnhoff K, Ahmad R, Alcantar A, Lyon MD, Schneider DL, Kornfeld K. Cadmium hijacks the high zinc response by binding and activating the HIZR-1 nuclear receptor. Proc Natl Acad Sci U S A 2021 118(42)   [ PubMed ID = 34649987 ] [ RRC reference ] Gerhard AP, Krücken J, Neveu C, Charvet CL, Harmache A, von Samson-Himmelstjerna G. Pharyngeal Pumping and Tissue-Specific Transgenic P-Glycoprotein Expression Influence Macrocyclic Lactone Susceptibility in Caenorhabditis elegans. Pharmaceuticals (Basel) 2021 14(2)   [ PubMed ID = 33668460 ] [ RRC reference ] Okahata M, Wei AD, Ohta A, Kuhara A. Cold acclimation via the KQT-2 potassium channel is modulated by oxygen in Caenorhabditis elegans. Sci Adv 2019 5(2) eaav3631  [ PubMed ID = 30775442 ] [ RRC reference ] Ohta A, Ujisawa T, Sonoda S, Kuhara A. Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans. Nat Commun 2014 5 4412  [ PubMed ID = 25048458 ] [ RRC reference ] C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25  [ PubMed ID = 23173093 ] [ RRC reference ] Levitte S, Salesky R, King B, Coe Smith S, Depper M, Cole M, Hermann GJ. A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function. FEBS J 2010 277(6) 1420-39  [ PubMed ID = 20148972 ] [ RRC reference ] Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L. Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7. Genetics 2008 178(2) 801-14  [ PubMed ID = 18245353 ] [ RRC reference ]