分離済み変異体

tm8264

Allele Nametm8264
BalanceNot Required
OutCrossRequest Available
Sequence NameK12G11.2
Gene Namesulp-5
Worm BaseAllele Name tm8264
Gene Name sulp-5
Sequence K12G11.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13264/13265-13378/13379 (114 bp deletion)
ChromosomeV
Putative gene structurejoin(10466..10543, 10588..10673, 10756..10910, 11131..11402, 11445..11612, 11656..11817, 11864..11946, 11997..12432, 12509..12615, 12663..12800, 12844..12982, 13044..13206, 13252..13367)
Map position3.5
Balancer
Map position of balancer
Sequence of primersExtRev:GCACGTACACATTCTGCAAC,ExtFwd:GCAGGCAAGGGAAGCAAGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Snoozy J, Bhattacharya S, Johnson B, Fettig RR, Van Asma A, Brede C, Miller SG, Ralle M, Warnhoff K.
XDH-1 inactivation causes xanthine stone formation in Caenorhabditis elegans which is inhibited by SULP-4-mediated anion exchange in the excretory cell.
PLoS Biol 2025 23(9) e3003410 
[ PubMed ID = 40991662 ] [ RRC reference ]

Snoozy J, Bhattacharya S, Fettig RR, Van Asma A, Brede C, Warnhoff K.
XDH-1 inactivation causes xanthine stone formation in C. elegans which is inhibited by SULP-4-mediated anion exchange in the excretory cell.
bioRxiv 2025   
[ PubMed ID = 39975063 ] [ RRC reference ]