| Allele Name | tm8264 |
| Balance | Not Required |
| OutCross | Request Available |
| Sequence Name | K12G11.2 |
| Gene Name | sulp-5 |
| Worm Base | Allele Name |
tm8264
|
| Gene Name |
sulp-5
|
| Sequence |
K12G11.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 13264/13265-13378/13379 (114 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(10466..10543, 10588..10673, 10756..10910, 11131..11402, 11445..11612, 11656..11817, 11864..11946, 11997..12432, 12509..12615, 12663..12800, 12844..12982, 13044..13206, 13252..13367) |
| Map position | 3.5 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:GCACGTACACATTCTGCAAC,ExtFwd:GCAGGCAAGGGAAGCAAGTT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Snoozy J, Bhattacharya S, Johnson B, Fettig RR, Van Asma A, Brede C, Miller SG, Ralle M, Warnhoff K. XDH-1 inactivation causes xanthine stone formation in Caenorhabditis elegans which is inhibited by SULP-4-mediated anion exchange in the excretory cell. PLoS Biol 2025 23(9) e3003410
[ PubMed ID = 40991662 ]
[ RRC reference ]
|
Snoozy J, Bhattacharya S, Fettig RR, Van Asma A, Brede C, Warnhoff K. XDH-1 inactivation causes xanthine stone formation in C. elegans which is inhibited by SULP-4-mediated anion exchange in the excretory cell. bioRxiv 2025
[ PubMed ID = 39975063 ]
[ RRC reference ]
|
|