| Allele Name | tm8231 |
| Balance | Not Required |
| OutCross | Request Available |
| Sequence Name | C10G11.5 |
| Gene Name | pnk-1 |
| Worm Base | Allele Name |
tm8231
|
| Gene Name |
pnk-1
|
| Sequence |
C10G11.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 23143/23144-23216/23217 (73 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(23414..23524, 23593..23651, 24242..24432, 24482..24648, 24703..24908, 24988..25163, 25209..25438, 25488..25607, 25664..25753) |
| Map position | 0.9 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ACATCGGTACATTCTACTGC,ExtRev:CCTCAAGTTTGGCGGACTGC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Shalash R, Solomon DM, Levi-Ferber M, von Chrzanowski H, Atrash MK, Nakar B, Avivi MY, Hauschner H, Swisa A, Meléndez A, Shav-Tal Y, Henis-Korenblit S. HLH-30/TFEB Rewires the Chaperone Network to Promote Proteostasis Upon Perturbations to the Coenzyme A and Iron-Sulfur Cluster Biosynthesis Pathways. Aging Cell 2025 24(6) e70038
[ PubMed ID = 40304211 ]
[ RRC reference ]
|
Shalash R, Levi-Ferber M, von Chrzanowski H, Atrash MK, Shav-Tal Y, Henis-Korenblit S. HLH-30/TFEB rewires the chaperone network to promote proteostasis under conditions of Coenzyme A and Iron-Sulfur Cluster Deficiency. bioRxiv 2024
[ PubMed ID = 38895373 ]
[ RRC reference ]
|
|