分離済み変異体

tm8231

Allele Nametm8231
BalanceNot Required
OutCrossRequest Available
Sequence NameC10G11.5
Gene Namepnk-1
Worm BaseAllele Name tm8231
Gene Name pnk-1
Sequence C10G11.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 23143/23144-23216/23217 (73 bp deletion)
ChromosomeI
Putative gene structurejoin(23414..23524, 23593..23651, 24242..24432, 24482..24648, 24703..24908, 24988..25163, 25209..25438, 25488..25607, 25664..25753)
Map position0.9
Balancer
Map position of balancer
Sequence of primersExtFwd:ACATCGGTACATTCTACTGC,ExtRev:CCTCAAGTTTGGCGGACTGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shalash R, Solomon DM, Levi-Ferber M, von Chrzanowski H, Atrash MK, Nakar B, Avivi MY, Hauschner H, Swisa A, Meléndez A, Shav-Tal Y, Henis-Korenblit S.
HLH-30/TFEB Rewires the Chaperone Network to Promote Proteostasis Upon Perturbations to the Coenzyme A and Iron-Sulfur Cluster Biosynthesis Pathways.
Aging Cell 2025 24(6) e70038 
[ PubMed ID = 40304211 ] [ RRC reference ]

Shalash R, Levi-Ferber M, von Chrzanowski H, Atrash MK, Shav-Tal Y, Henis-Korenblit S.
HLH-30/TFEB rewires the chaperone network to promote proteostasis under conditions of Coenzyme A and Iron-Sulfur Cluster Deficiency.
bioRxiv 2024   
[ PubMed ID = 38895373 ] [ RRC reference ]