分離済み変異体

tm812

Allele Nametm812
BalanceNot Required
OutCrossNot Accepted
Sequence NameF28H6.1a
Gene Nameakt-2
Worm BaseAllele Name tm812
Gene Name akt-2
Sequence F28H6.1a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Homozygous viable. Dr. K. Ashrafi: substantially increased fat (nile red staining). PLoS Biol, 7, e1000060, 0604 (2009). Dr. W.B. Derry: mild hypersensitivity to ionizing radiation induced germ cell apoptosis.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [F28H6]37780/37781-TA-[R03E1]430/431 (522 bp deletion + 2 bp insertion)
ChromosomeX
Putative gene structurejoin(35289..35383, 35587..35695, 36588..36788, 36832..36951, 37176..37373, 37845..37975, Z92837:104..164, Z92837:275..403, Z92837:451..813, Z92837:1091..1270)
Map position16.55
Balancer
Map position of balancer
Sequence of primersExtFwd:TTATGCGGATAGCGCCGACT,IntFwd:GTCAGATGTGGATTGAAGCA,ExtRev:CTGTCGGAAGTTCTTCCCCT,IntRev:TCTACGTGGAGGCGTCAGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ayuda-Durán B, González-Manzano S, González-Paramás AM, Santos-Buelga C.
Caernohabditis elegans as a Model Organism to Evaluate the Antioxidant Effects of Phytochemicals.
Molecules 2020 25(14)  
[ PubMed ID = 32668705 ] [ RRC reference ]

Ayuda-Durán B, González-Manzano S, Miranda-Vizuete A, Sánchez-Hernández E, R Romero M, Dueñas M, Santos-Buelga C, González-Paramás AM.
Exploring Target Genes Involved in the Effect of Quercetin on the Response to Oxidative Stress in Caenorhabditis elegans.
Antioxidants (Basel) 2019 8(12)  
[ PubMed ID = 31775265 ] [ RRC reference ]

Ayuda-Durán B, González-Manzano S, Miranda-Vizuete A, Dueñas M, Santos-Buelga C, González-Paramás AM.
Epicatechin modulates stress-resistance in C. elegans via insulin/IGF-1 signaling pathway.
PLoS One 2019 14(1) e0199483 
[ PubMed ID = 30689636 ] [ RRC reference ]

Chen AT, Guo C, Dumas KJ, Ashrafi K, Hu PJ.
Effects of Caenorhabditis elegans sgk-1 mutations on lifespan, stress resistance, and DAF-16/FoxO regulation.
Aging Cell 2013 12(5) 932-40 
[ PubMed ID = 23786484 ] [ RRC reference ]

Alan JK, Struckhoff EC, Lundquist EA.
Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans.
Small GTPases 2013 4(4) 208-20 
[ PubMed ID = 24149939 ] [ RRC reference ]

Jones KT, Greer ER, Pearce D, Ashrafi K.
Rictor/TORC2 regulates Caenorhabditis elegans fat storage, body size, and development through sgk-1.
PLoS Biol 2009 7(3) e60 
[ PubMed ID = 19260765 ] [ RRC reference ]