| Allele Name | tm808 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F32D1.1 |
| Gene Name | figl-1 |
| Worm Base | Allele Name |
tm808
(x1) |
| Gene Name |
figl-1
|
| Sequence |
F32D1.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| Lethal or sterile. Dr. T. Ogura: sterile. Dr. M. Peter: J. Cell Sci 120, 3179 (2007). |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 3063/3064-TA-4129/4130 (1066 bp deletion + 2 bp insertion) |
| Chromosome | V |
| Putative gene structure | complement(join(128..265, 1137..1767, 2779..3210, 3914..4497)) |
| Map position | -5.91 |
| Balancer | unc-62(e644) V |
| Map position of balancer | |
| Sequence of primers | ExtRev:TAGAACCGTTGATGTGTCGT,IntRev:AAACAAGACACCCGGAAGCT,ExtFwd:GCAGTACAACAATCTCCCGT,IntFwd:TTTTCGCTCCTTCCAATCCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Onitake A, Yamanaka K, Esaki M, Ogura T. Caenorhabditis elegans fidgetin homolog FIGL-1, a nuclear-localized AAA ATPase, binds to SUMO. J Struct Biol 2012 179(2) 143-51
[ PubMed ID = 22575764 ]
[ RRC reference ]
|
Luke-Glaser S, Pintard L, Tyers M, Peter M. The AAA-ATPase FIGL-1 controls mitotic progression, and its levels are regulated by the CUL-3MEL-26 E3 ligase in the C. elegans germ line. J Cell Sci 2007 120(Pt 18) 3179-87
[ PubMed ID = 17878235 ]
[ RRC reference ]
|
|