Allele Name | tm797 |
Allele Type | 通常株 |
Sequence Name | F11D5.3 |
Gene Name | F11D5.3 |
Worm Base | Allele Name |
tm797
|
Gene Name |
F11D5.3
|
Sequence |
F11D5.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. T. Schedl: fertile, normal locomotion. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 19813/19814-20162/20163 (349 bp deletion) |
Chromosome | X |
Putative gene structure | join(13790..13856, 16299..16404, 17621..17718, 17768..17901, 19471..19618, 19728..20017, 20062..20374, 20428..20695, 20915..20986, 21035..21261, 21311..21440, 21488..21565, 21894..22200, 22251..22406) |
Map position | -10.56 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:CGACATCTTGACCGGGCAAT,ExtFwd:GCTAATAATGACACGGAGCA,IntRev:CTTTCGAGCTACAGGTAAAG,ExtRev:GGAGCACTGGGAGTCTAGGA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Shimizu T, Kato Y, Sakai Y, Hisamoto N, Matsumoto K. N-Glycosylation of the Discoidin Domain Receptor Is Required for Axon Regeneration in Caenorhabditis elegans. Genetics 2019 213(2) 491-500
[ PubMed ID = 31371405 ]
[ RRC reference ]
|
Hisamoto N, Nagamori Y, Shimizu T, Pastuhov SI, Matsumoto K. The C. elegans Discoidin Domain Receptor DDR-2 Modulates the Met-like RTK-JNK Signaling Pathway in Axon Regeneration. PLoS Genet 2016 12(12) e1006475
[ PubMed ID = 27984580 ]
[ RRC reference ]
|
Unsoeld T, Park JO, Hutter H. Discoidin domain receptors guide axons along longitudinal tracts in C. elegans. Dev Biol 2013 374(1) 142-52
[ PubMed ID = 23147028 ]
[ RRC reference ]
|
|