分離済み変異体

tm794

Allele Nametm794
Allele Type通常株
Sequence NameC16C10.7
Gene Namernf-5
Worm BaseAllele Name tm794
Gene Name rnf-5
Sequence C16C10.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Z. Ronai: J. Cell Biol. 165, 857-867 (2004).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22868/22869-23515/23516 (647 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(21889..22010, 22436..22706, 23264..23510, 24112..24179))
Map position-3.74
Balancer
Map position of balancer
Sequence of primersIntRev:CAATGGCGTCGGAGACGAAA,IntFwd:TGTCCACGGGGTCCTGAAAA,ExtFwd:TGATCCCGGTGCAGCTGATT,ExtRev:ATTTCAGAGTTCGGAGCCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Taylor CA, Maor-Nof M, Metzl-Raz E, Hidalgo A, Yee C, Gitler AD, Shen K.
Histone deacetylase inhibition expands cellular proteostasis repertoires to enhance neuronal stress resilience.
bioRxiv 2024   
[ PubMed ID = 39229034 ] [ RRC reference ]

Cheung TP, Choe JY, Richmond JE, Kim H.
BK channel density is regulated by endoplasmic reticulum associated degradation and influenced by the SKN-1A/NRF1 transcription factor.
PLoS Genet 2020 16(6) e1008829 
[ PubMed ID = 32502151 ] [ RRC reference ]

Zaidel-Bar R, Miller S, Kaminsky R, Broday L.
Molting-specific downregulation of C. elegans body-wall muscle attachment sites: the role of RNF-5 E3 ligase.
Biochem Biophys Res Commun 2010 395(4) 509-14 
[ PubMed ID = 20385102 ] [ RRC reference ]

Darom A, Bening-Abu-Shach U, Broday L.
RNF-121 is an endoplasmic reticulum-membrane E3 ubiquitin ligase involved in the regulation of beta-integrin.
Mol Biol Cell 2010 21(11) 1788-98 
[ PubMed ID = 20357004 ] [ RRC reference ]

Kuang E, Okumura CY, Sheffy-Levin S, Varsano T, Shu VC, Qi J, Niesman IR, Yang HJ, López-Otín C, Yang WY, Reed JC, Broday L, Nizet V, Ronai ZA.
Regulation of ATG4B stability by RNF5 limits basal levels of autophagy and influences susceptibility to bacterial infection.
PLoS Genet 2012 8(10) e1003007 
[ PubMed ID = 23093945 ] [ RRC reference ]

Kovacevic I, Ho R, Cram EJ.
CCDC-55 is required for larval development and distal tip cell migration in Caenorhabditis elegans.
Mech Dev 2012 128(11-12) 548-59 
[ PubMed ID = 22285439 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J Neurosci 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]

Broday L, Kolotuev I, Didier C, Bhoumik A, Podbilewicz B, Ronai Z.
The LIM domain protein UNC-95 is required for the assembly of muscle attachment structures and is regulated by the RING finger protein RNF-5 in C. elegans.
J Cell Biol 2004 165(6) 857-67 
[ PubMed ID = 15210732 ] [ RRC reference ]