分離済み変異体

tm788

Allele Nametm788
BalanceNot Required
OutCrossNot Accepted
Sequence NameT18D3.3
Gene Namecdf-2
Worm BaseAllele Name tm788
Gene Name cdf-2
Sequence T18D3.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28668/28669-AAAGCAATATAAATTTTAAAAGCAATACCTCTCCGATTGCTATCATGTGAATCTGTTGAGTCAGCTTC-29472/29473 (804 bp deletion +69 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(26870..27043, 27088..27194, 27506..27611, 27693..27876, 28147..28300, 28348..28557, 28625..28737, 29176..29276))
Map position7.11
Balancer
Map position of balancer
Sequence of primersExtRev:GCTCTTCCTGCCATTTTGCT,ExtFwd:GCTCGGACGTTGATGTTATC,IntRev:CCACACAACCACTTTAGCGA,IntFwd:CCGTTGCCACCACCATGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dejima K, Imae R, Suehiro Y, Yoshida K, Mitani S.
An endomembrane zinc transporter negatively regulates systemic RNAi in Caenorhabditis elegans.
iScience 2023 26(6) 106930 
[ PubMed ID = 37305693 ] [ RRC reference ]

Sharma AK, Finney L, Vogt S, Vatamaniuk OK, Kim S.
Cadmium alters whole animal ionome and promotes the re-distribution of iron in intestinal cells of Caenorhabditis elegans.
Front Physiol 2023 14 1258540 
[ PubMed ID = 37822680 ] [ RRC reference ]

Earley BJ, Cubillas C, Warnhoff K, Ahmad R, Alcantar A, Lyon MD, Schneider DL, Kornfeld K.
Cadmium hijacks the high zinc response by binding and activating the HIZR-1 nuclear receptor.
Proc Natl Acad Sci U S A 2021 118(42)  
[ PubMed ID = 34649987 ] [ RRC reference ]

Hu Y, Wang Y, Wang X, Wu X, Fu L, Liu X, Wen Y, Sheng J, Zhang J.
The role of cation diffusion facilitator CDF-1 in lipid metabolism in Caenorhabditis elegans.
G3 (Bethesda) 2021 11(7)  
[ PubMed ID = 33871589 ] [ RRC reference ]

Luallen RJ, Bakowski MA, Troemel ER.
Characterization of microsporidia-induced developmental arrest and a transmembrane leucine-rich repeat protein in Caenorhabditis elegans.
PLoS One 2015 10(4) e0124065 
[ PubMed ID = 25874557 ] [ RRC reference ]

Roh HC, Collier S, Deshmukh K, Guthrie J, Robertson JD, Kornfeld K.
ttm-1 encodes CDF transporters that excrete zinc from intestinal cells of C. elegans and act in a parallel negative feedback circuit that promotes homeostasis.
PLoS Genet 2013 9(5) e1003522 
[ PubMed ID = 23717214 ] [ RRC reference ]

Roh HC, Collier S, Guthrie J, Robertson JD, Kornfeld K.
Lysosome-related organelles in intestinal cells are a zinc storage site in C. elegans.
Cell Metab 2012 15(1) 88-99 
[ PubMed ID = 22225878 ] [ RRC reference ]

Murphy JT, Bruinsma JJ, Schneider DL, Collier S, Guthrie J, Chinwalla A, Robertson JD, Mardis ER, Kornfeld K.
Histidine protects against zinc and nickel toxicity in Caenorhabditis elegans.
PLoS Genet 2011 7(3) e1002013 
[ PubMed ID = 21455490 ] [ RRC reference ]

Davis DE, Roh HC, Deshmukh K, Bruinsma JJ, Schneider DL, Guthrie J, Robertson JD, Kornfeld K.
The cation diffusion facilitator gene cdf-2 mediates zinc metabolism in Caenorhabditis elegans.
Genetics 2009 182(4) 1015-33 
[ PubMed ID = 19448268 ] [ RRC reference ]