分離済み変異体

tm776

Allele Name

tm776

Allele Type

通常株

Sequence Name

C15F1.7

Gene Name

sod-1

Worm Base

Allele Name

tm776

Gene Name

sod-1

Sequence

C15F1.7

Phenotype

homozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: slightly short life span on 20C, dauer arrest abnormal. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).Dr. O. Hobert: Nat. Neurosci. 11, 894 (2008).

Mutation site

17154/17155-17766/17767 (612 bp deletion)

Chromosome

Putative gene structure

complement(join(17270..17367, 17412..17565, 17610..17768, 17812..17895, 18227..18274))

Map position

0.2

Balancer

Map position of balancer

Sequence of primers

IntFwd:CTGGCACAACATTTATGGCA,ExtFwd:TCTCCGTCAGAACTTGTTGA,ExtRev:AGAGGCCCTCCTCTCATTGT,IntRev:GGGGTCAAGGGGTCAAAGTT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Chen H, Li R, Zhao F, Luan L, Han T, Li Z.
Betulinic acid increases lifespan and stress resistance via insulin/IGF-1 signaling pathway in Caenorhabditis elegans.
Front Nutr 2022 9 960239
[ PubMed ID = 35967806 ] [ RRC reference ]

Yu CY, Chang HC.
Glutamate signaling mediates C. elegans behavioral plasticity to pathogens.
iScience 2022 25(3) 103919
[ PubMed ID = 35252815 ] [ RRC reference ]

Hershberger KA, Rooney JP, Turner EA, Donoghue LJ, Bodhicharla R, Maurer LL, Ryde IT, Kim JJ, Joglekar R, Hibshman JD, Smith LL, Bhatt DP, Ilkayeva OR, Hirschey MD, Meyer JN.
Early-life mitochondrial DNA damage results in lifelong deficits in energy production mediated by redox signaling in Caenorhabditis elegans.
Redox Biol 2021 43 102000
[ PubMed ID = 33993056 ] [ RRC reference ]

Fernando LM, Adeel S, Basar MA, Allen AK, Duttaroy A.
In-gel SOD assay reveals SOD-2 is the single active, water-soluble SOD enzyme in C. elegans.
Free Radic Res 2021 55(6) 619-624
[ PubMed ID = 34514925 ] [ RRC reference ]

Yanase S, Yasuda K, Ishii N.
Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans.
Biochem Biophys Rep 2020 23 100796
[ PubMed ID = 32875124 ] [ RRC reference ]

Tjahjono E, McAnena AP, Kirienko NV.
The evolutionarily conserved ESRE stress response network is activated by ROS and mitochondrial damage.
BMC Biol 2020 18(1) 74
[ PubMed ID = 32600387 ] [ RRC reference ]

Kelley CA, De Henau S, Bell L, Dansen TB, Cram EJ.
Redox signaling modulates Rho activity and tissue contractility in the Caenorhabditis elegans spermatheca.
Mol Biol Cell 2020 31(14) 1486-1497
[ PubMed ID = 32374641 ] [ RRC reference ]

Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671
[ PubMed ID = 32009302 ] [ RRC reference ]

Hodgkin J.
Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration.
J Dev Biol 2019 7(4)
[ PubMed ID = 31771156 ] [ RRC reference ]

Baskoylu SN, Yersak J, O'Hern P, Grosser S, Simon J, Kim S, Schuch K, Dimitriadi M, Yanagi KS, Lins J, Hart AC.
Single copy/knock-in models of ALS SOD1 in C. elegans suggest loss and gain of function have different contributions to cholinergic and glutamatergic neurodegeneration.
PLoS Genet 2018 14(10) e1007682
[ PubMed ID = 30296255 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285
[ PubMed ID = 30049781 ] [ RRC reference ]

Nam YW, Baskoylu SN, Gazgalis D, Orfali R, Cui M, Hart AC, Zhang M.
A V-to-F substitution in SK2 channels causes Ca²⁺ hypersensitivity and improves locomotion in a C. elegans ALS model.
Sci Rep 2018 8(1) 10749
[ PubMed ID = 30013223 ] [ RRC reference ]

Luz AL, Godebo TR, Bhatt DP, Ilkayeva OR, Maurer LL, Hirschey MD, Meyer JN.
From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.
Toxicol Sci 2016 152(2) 349-62
[ PubMed ID = 27208080 ] [ RRC reference ]

Xu S, Chisholm AD.
Highly efficient optogenetic cell ablation in C. elegans using membrane-targeted miniSOG.
Sci Rep 2016 6 21271
[ PubMed ID = 26861262 ] [ RRC reference ]

Na HS, Brockway NL, Gentry KR, Opheim E, Sedensky MM, Morgan PG.
The genetics of isoflurane-induced developmental neurotoxicity.
Neurotoxicol Teratol 2017 60 40-49
[ PubMed ID = 27989695 ] [ RRC reference ]

Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979
[ PubMed ID = 29367452 ] [ RRC reference ]

Sakamoto T, Imai H.
Hydrogen peroxide produced by superoxide dismutase SOD-2 activates sperm in Caenorhabditis elegans.
J Biol Chem 2017 292(36) 14804-14813
[ PubMed ID = 28724632 ] [ RRC reference ]

Le TT, Duren HM, Slipchenko MN, Hu CD, Cheng JX.
Label-free quantitative analysis of lipid metabolism in living Caenorhabditis elegans.
J Lipid Res 2010 51(3) 672-7
[ PubMed ID = 19776402 ] [ RRC reference ]

Yang Y, Han SM, Miller MA.
MSP hormonal control of the oocyte MAP kinase cascade and reactive oxygen species signaling.
Dev Biol 2010 342(1) 96-107
[ PubMed ID = 20380830 ] [ RRC reference ]