分離済み変異体

tm760

Allele Nametm760
Allele Type通常株
Sequence NameC08A9.1
Gene Namesod-3
Worm BaseAllele Name tm760
Gene Name sod-3
Sequence C08A9.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. W.B. Derry: WT morphology. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: normal lifespan on 20C. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14553/14554-15268/15269 (715 bp deletion)
ChromosomeX
Putative gene structurejoin(14359..14411, 14826..14998, 15047..15183, 15344..15586, 15638..15688)
Map position24.07
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGAAATGTTTGTCGGTGGT,ExtRev:CCAAAGGATCCTGGTTTGCA,IntFwd:CGGTGGTATGCTCGAATATT,IntRev:ACAGGTGGCGATCTTCAAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fan S, Zhang Y, Ainslie AP, Seinstra R, Zhang T, Nollen E, Schirhagl R.
In Vivo Nanodiamond Quantum Sensing of Free Radicals in Caenorhabditis elegans Models.
Adv Sci (Weinh) 2025 12(14) e2412300 
[ PubMed ID = 39812229 ] [ RRC reference ]

Jia Q, Young D, Zhang Q, Sieburth D.
Endogenous hydrogen peroxide positively regulates secretion of a gut-derived peptide in neuroendocrine potentiation of the oxidative stress response in Caenorhabditis elegans.
Elife 2024 13  
[ PubMed ID = 39636673 ] [ RRC reference ]

Liu Y, Li Q, Tian G, Zhou X, Chen P, Chen B, Shan Z, Qi B.
Neuronal PRDX-2-Mediated ROS Signaling Regulates Food Digestion via peripheral UPRmt Activation.
Nat Commun 2024 15(1) 10582 
[ PubMed ID = 39632952 ] [ RRC reference ]

Jia Q, Young D, Zhang Q, Sieburth D.
Endogenous hydrogen peroxide positively regulates secretion of a gut-derived peptide in neuroendocrine potentiation of the oxidative stress response in C. elegans.
bioRxiv 2024   
[ PubMed ID = 39345448 ] [ RRC reference ]

Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705 
[ PubMed ID = 38239833 ] [ RRC reference ]

Zhao L, Wu B, Liang S, Min D, Jiang H.
Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans.
Foods 2022 11(24)  
[ PubMed ID = 36553826 ] [ RRC reference ]

Zhao L, Fenk LA, Nilsson L, Amin-Wetzel NP, Ramirez-Suarez NJ, de Bono M, Chen C.
ROS and cGMP signaling modulate persistent escape from hypoxia in Caenorhabditis elegans.
PLoS Biol 2022 20(6) e3001684 
[ PubMed ID = 35727855 ] [ RRC reference ]

Onukwufor JO, Farooqi MA, Vodičková A, Koren SA, Baldzizhar A, Berry BJ, Beutner G, Porter GA Jr, Belousov V, Grossfield A, Wojtovich AP.
A reversible mitochondrial complex I thiol switch mediates hypoxic avoidance behavior in C. elegans.
Nat Commun 2022 13(1) 2403 
[ PubMed ID = 35504873 ] [ RRC reference ]

Huang M, Hong M, Hou X, Zhu C, Chen D, Chen X, Guang S, Feng X.
H3K9me1/2 methylation limits the lifespan of daf-2 mutants in C. elegans.
Elife 2022 11  
[ PubMed ID = 36125117 ] [ RRC reference ]

Chen H, Li R, Zhao F, Luan L, Han T, Li Z.
Betulinic acid increases lifespan and stress resistance via insulin/IGF-1 signaling pathway in Caenorhabditis elegans.
Front Nutr 2022 9 960239 
[ PubMed ID = 35967806 ] [ RRC reference ]

Branicky R, Wang Y, Khaki A, Liu JL, Kramer-Drauberg M, Hekimi S.
Stimulation of RAS-dependent ROS signaling extends longevity by modulating a developmental program of global gene expression.
Sci Adv 2022 8(48) eadc9851 
[ PubMed ID = 36449615 ] [ RRC reference ]

Peng Y, Dai S, Lu Y, Xiong L, Huang J, Liu Z, Gong Y.
Theanine Improves High-Dose Epigallocatechin-3-Gallate-Induced Lifespan Reduction in Caenorhabditis elegans.
Foods 2021 10(6)  
[ PubMed ID = 34204441 ] [ RRC reference ]

Hershberger KA, Rooney JP, Turner EA, Donoghue LJ, Bodhicharla R, Maurer LL, Ryde IT, Kim JJ, Joglekar R, Hibshman JD, Smith LL, Bhatt DP, Ilkayeva OR, Hirschey MD, Meyer JN.
Early-life mitochondrial DNA damage results in lifelong deficits in energy production mediated by redox signaling in Caenorhabditis elegans.
Redox Biol 2021 43 102000 
[ PubMed ID = 33993056 ] [ RRC reference ]

Gaidamakova EK, Sharma A, Matrosova VY, Grichenko O, Volpe RP, Tkavc R, Conze IH, Klimenkova P, Balygina I, Horne WH, Gostinčar C, Chen X, Makarova KS, Shuryak I, Srinivasan C, Jackson-Thompson B, Hoffman BM, Daly MJ.
Small-Molecule Mn Antioxidants in Caenorhabditis elegans and Deinococcus radiodurans Supplant MnSOD Enzymes during Aging and Irradiation.
mBio 2022 13(1) e0339421 
[ PubMed ID = 35012337 ] [ RRC reference ]

Fernando LM, Adeel S, Basar MA, Allen AK, Duttaroy A.
In-gel SOD assay reveals SOD-2 is the single active, water-soluble SOD enzyme in C. elegans.
Free Radic Res 2021 55(6) 619-624 
[ PubMed ID = 34514925 ] [ RRC reference ]

Taylor SKB, Minhas MH, Tong J, Selvaganapathy PR, Mishra RK, Gupta BP.
C. elegans electrotaxis behavior is modulated by heat shock response and unfolded protein response signaling pathways.
Sci Rep 2021 11(1) 3115 
[ PubMed ID = 33542359 ] [ RRC reference ]

Tjahjono E, McAnena AP, Kirienko NV.
The evolutionarily conserved ESRE stress response network is activated by ROS and mitochondrial damage.
BMC Biol 2020 18(1) 74 
[ PubMed ID = 32600387 ] [ RRC reference ]

Pham TTH, Huang WY, Chen CS, Chiu WT, Chuang HS.
Effects of electrotactic exercise and antioxidant EUK-134 on oxidative stress relief in Caenorhabditis elegans.
PLoS One 2021 16(1) e0245474 
[ PubMed ID = 33471830 ] [ RRC reference ]

Dues DJ, Andrews EK, Senchuk MM, Van Raamsdonk JM.
Resistance to Stress Can Be Experimentally Dissociated From Longevity.
J Gerontol A Biol Sci Med Sci 2019 74(8) 1206-1214 
[ PubMed ID = 30247515 ] [ RRC reference ]

Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, Machiela E, Schaar CE, DeJonge H, Blackwell TK, Van Raamsdonk JM.
Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways.
BMC Biol 2018 16(1) 147 
[ PubMed ID = 30563508 ] [ RRC reference ]