分離済み変異体

tm760

Allele Name

tm760

Balance

Not Required

OutCross

Not Accepted

Sequence Name

C08A9.1

Gene Name

sod-3

Worm Base

Allele Name

tm760

Gene Name

sod-3

Sequence

C08A9.1

Phenotype

homozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. W.B. Derry: WT morphology. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: normal lifespan on 20C. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).

Mutation site

14553/14554-15268/15269 (715 bp deletion)

Chromosome

Putative gene structure

join(14359..14411, 14826..14998, 15047..15183, 15344..15586, 15638..15688)

Map position

24.07

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TGGAAATGTTTGTCGGTGGT,ExtRev:CCAAAGGATCCTGGTTTGCA,IntFwd:CGGTGGTATGCTCGAATATT,IntRev:ACAGGTGGCGATCTTCAAGA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Agrawal S, Babu KR.
Systematic optimization of Caenorhabditis elegans cryopreservation.
Biochem Biophys Rep 2025 44 102383
[ PubMed ID = 41362646 ] [ RRC reference ]

Pu L, Zhao L, Wang J, Deleuze C, Nilsson L, Henriksson J, Laurent P, Chen C.
Avoidance of hydrogen sulfide is modulated by external and internal states in Caenorhabditis elegans.
Elife 2025 12
[ PubMed ID = 41288154 ] [ RRC reference ]

Ding L, Zhang J, Qiao S, Xu J, Li J, Zhang W, Yi Q, Wu Y, Wang T, Bian P.
The Effects of Feeding ybfQ-Deficient Gut Bacteria on Radio-Tolerance in Symbiotic Caenorhabditis elegans: The Key Role of Isoscoparin.
Microorganisms 2025 13(11)
[ PubMed ID = 41304310 ] [ RRC reference ]

Salcedo-Tacuma D, Asad N, Islam MQ, Anderson R, Smith DM.
Hyperactive 20S proteasome enhances proteostasis and ERAD in C. elegans via degradation of intrinsically disordered proteins.
Sci Adv 2025 11(41) eadx3014
[ PubMed ID = 41071871 ] [ RRC reference ]

Fan S, Zhang Y, Ainslie AP, Seinstra R, Zhang T, Nollen E, Schirhagl R.
In Vivo Nanodiamond Quantum Sensing of Free Radicals in Caenorhabditis elegans Models.
Adv Sci (Weinh) 2025 12(14) e2412300
[ PubMed ID = 39812229 ] [ RRC reference ]

Jia Q, Young D, Zhang Q, Sieburth D.
Endogenous hydrogen peroxide positively regulates secretion of a gut-derived peptide in neuroendocrine potentiation of the oxidative stress response in Caenorhabditis elegans.
Elife 2024 13
[ PubMed ID = 39636673 ] [ RRC reference ]

Liu Y, Li Q, Tian G, Zhou X, Chen P, Chen B, Shan Z, Qi B.
Neuronal PRDX-2-Mediated ROS Signaling Regulates Food Digestion via peripheral UPR^mt Activation.
Nat Commun 2024 15(1) 10582
[ PubMed ID = 39632952 ] [ RRC reference ]

Jia Q, Young D, Zhang Q, Sieburth D.
Endogenous hydrogen peroxide positively regulates secretion of a gut-derived peptide in neuroendocrine potentiation of the oxidative stress response in C. elegans.
bioRxiv 2024
[ PubMed ID = 39345448 ] [ RRC reference ]

Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705
[ PubMed ID = 38239833 ] [ RRC reference ]

Zhao L, Wu B, Liang S, Min D, Jiang H.
Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans.
Foods 2022 11(24)
[ PubMed ID = 36553826 ] [ RRC reference ]

Branicky R, Wang Y, Khaki A, Liu JL, Kramer-Drauberg M, Hekimi S.
Stimulation of RAS-dependent ROS signaling extends longevity by modulating a developmental program of global gene expression.
Sci Adv 2022 8(48) eadc9851
[ PubMed ID = 36449615 ] [ RRC reference ]

Huang M, Hong M, Hou X, Zhu C, Chen D, Chen X, Guang S, Feng X.
H3K9me1/2 methylation limits the lifespan of daf-2 mutants in C. elegans.
Elife 2022 11
[ PubMed ID = 36125117 ] [ RRC reference ]

Zhao L, Fenk LA, Nilsson L, Amin-Wetzel NP, Ramirez-Suarez NJ, de Bono M, Chen C.
ROS and cGMP signaling modulate persistent escape from hypoxia in Caenorhabditis elegans.
PLoS Biol 2022 20(6) e3001684
[ PubMed ID = 35727855 ] [ RRC reference ]

Onukwufor JO, Farooqi MA, Vodičková A, Koren SA, Baldzizhar A, Berry BJ, Beutner G, Porter GA Jr, Belousov V, Grossfield A, Wojtovich AP.
A reversible mitochondrial complex I thiol switch mediates hypoxic avoidance behavior in C. elegans.
Nat Commun 2022 13(1) 2403
[ PubMed ID = 35504873 ] [ RRC reference ]

Gaidamakova EK, Sharma A, Matrosova VY, Grichenko O, Volpe RP, Tkavc R, Conze IH, Klimenkova P, Balygina I, Horne WH, Gostinčar C, Chen X, Makarova KS, Shuryak I, Srinivasan C, Jackson-Thompson B, Hoffman BM, Daly MJ.
Small-Molecule Mn Antioxidants in Caenorhabditis elegans and Deinococcus radiodurans Supplant MnSOD Enzymes during Aging and Irradiation.
mBio 2022 13(1) e0339421
[ PubMed ID = 35012337 ] [ RRC reference ]

Chen H, Li R, Zhao F, Luan L, Han T, Li Z.
Betulinic acid increases lifespan and stress resistance via insulin/IGF-1 signaling pathway in Caenorhabditis elegans.
Front Nutr 2022 9 960239
[ PubMed ID = 35967806 ] [ RRC reference ]

Hershberger KA, Rooney JP, Turner EA, Donoghue LJ, Bodhicharla R, Maurer LL, Ryde IT, Kim JJ, Joglekar R, Hibshman JD, Smith LL, Bhatt DP, Ilkayeva OR, Hirschey MD, Meyer JN.
Early-life mitochondrial DNA damage results in lifelong deficits in energy production mediated by redox signaling in Caenorhabditis elegans.
Redox Biol 2021 43 102000
[ PubMed ID = 33993056 ] [ RRC reference ]

Peng Y, Dai S, Lu Y, Xiong L, Huang J, Liu Z, Gong Y.
Theanine Improves High-Dose Epigallocatechin-3-Gallate-Induced Lifespan Reduction in Caenorhabditis elegans.
Foods 2021 10(6)
[ PubMed ID = 34204441 ] [ RRC reference ]

Fernando LM, Adeel S, Basar MA, Allen AK, Duttaroy A.
In-gel SOD assay reveals SOD-2 is the single active, water-soluble SOD enzyme in C. elegans.
Free Radic Res 2021 55(6) 619-624
[ PubMed ID = 34514925 ] [ RRC reference ]

Taylor SKB, Minhas MH, Tong J, Selvaganapathy PR, Mishra RK, Gupta BP.
C. elegans electrotaxis behavior is modulated by heat shock response and unfolded protein response signaling pathways.
Sci Rep 2021 11(1) 3115
[ PubMed ID = 33542359 ] [ RRC reference ]