| Allele Name | tm7561 |
| Balance | Not Required |
| OutCross | Completed |
| Sequence Name | K10C8.2 |
| Gene Name | frpr-15 |
| Worm Base | Allele Name |
tm7561
(x1) |
| Gene Name |
frpr-15
|
| Sequence |
K10C8.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 9393/9394-9480/9481 (87 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(9127..9273, 9329..9580, 9627..9760, 9812..9970, 10254..10566, 10630..10753, 10901..11049) |
| Map position | 4.61 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:CCCCCCGCATTTTTCGTAGA,ExtFwd:GAGTGGCATGTCATTGGACG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX. Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory. iScience 2025 28(4) 112215
[ PubMed ID = 40224011 ]
[ RRC reference ]
|
Chai CM, Park H, Sternberg PW. Brain-wide bidirectional neuropeptide modulation of individual neuron classes regulates a developmental decision. Curr Biol 2022 32(15) 3365-3373.e6
[ PubMed ID = 35679871 ]
[ RRC reference ]
|
|