Allele Name | tm737 |
Allele Type | 通常株 |
Sequence Name | T14E8.1 |
Gene Name | T14E8.1 |
Worm Base | Allele Name |
tm737
|
Gene Name |
T14E8.1
|
Sequence |
T14E8.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. K. Matsumoto: not sensitive to copper. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 18597/18598-ATTTTTAT-19243/19244 (646 bp deletion + 8 bp insertion) |
Chromosome | X |
Putative gene structure | join(16577..16750, 17388..17469, 17526..17634, 17682..17885, 17931..18181, 18229..18317, 18367..18582, 18627..18733, 18913..19015, 19063..19182, 19228..19416, 19465..19586, 19633..20025, 20269..20450, 20503..20755, 20803..20971, 21038..21204, 21760..21912, 22149..22356) |
Map position | -2.87 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:AGTCATTAGATTCTGCGCGA,ExtRev:ACCTTGGCCAATAGGATCCA,IntRev:TTGTCAACGCGCAGGTTCTT,IntFwd:GACAGATCAAACTGCAGACT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Shimizu T, Pastuhov SI, Hanafusa H, Sakai Y, Todoroki Y, Hisamoto N, Matsumoto K. Caenorhabditis elegans F-Box Protein Promotes Axon Regeneration by Inducing Degradation of the Mad Transcription Factor. J Neurosci 2021 41(11) 2373-2381
[ PubMed ID = 33514673 ]
[ RRC reference ]
|
Sakai Y, Hanafusa H, Pastuhov SI, Shimizu T, Li C, Hisamoto N, Matsumoto K. TDP2 negatively regulates axon regeneration by inducing SUMOylation of an Ets transcription factor. EMBO Rep 2019 20(10) e47517
[ PubMed ID = 31393064 ]
[ RRC reference ]
|
Hisamoto N, Shimizu T, Asai K, Sakai Y, Pastuhov SI, Hanafusa H, Matsumoto K. C. elegans Tensin Promotes Axon Regeneration by Linking the Met-like SVH-2 and Integrin Signaling Pathways. J Neurosci 2019 39(29) 5662-5672
[ PubMed ID = 31109965 ]
[ RRC reference ]
|
Hisamoto N, Nagamori Y, Shimizu T, Pastuhov SI, Matsumoto K. The C. elegans Discoidin Domain Receptor DDR-2 Modulates the Met-like RTK-JNK Signaling Pathway in Axon Regeneration. PLoS Genet 2016 12(12) e1006475
[ PubMed ID = 27984580 ]
[ RRC reference ]
|
Hisamoto N, Li C, Yoshida M, Matsumoto K. The C. elegans HGF/plasminogen-like protein SVH-1 has protease-dependent and -independent functions. Cell Rep 2014 9(5) 1628-1634
[ PubMed ID = 25464847 ]
[ RRC reference ]
|
Li C, Hisamoto N, Matsumoto K. Axon Regeneration Is Regulated by Ets-C/EBP Transcription Complexes Generated by Activation of the cAMP/Ca2+ Signaling Pathways. PLoS Genet 2015 11(10) e1005603
[ PubMed ID = 26484536 ]
[ RRC reference ]
|
Pastuhov SI, Fujiki K, Nix P, Kanao S, Bastiani M, Matsumoto K, Hisamoto N. Endocannabinoid-Goα signalling inhibits axon regeneration in Caenorhabditis elegans by antagonizing Gqα-PKC-JNK signalling. Nat Commun 2012 3 1136
[ PubMed ID = 23072806 ]
[ RRC reference ]
|
Li C, Hisamoto N, Nix P, Kanao S, Mizuno T, Bastiani M, Matsumoto K. The growth factor SVH-1 regulates axon regeneration in C. elegans via the JNK MAPK cascade. Nat Neurosci 2012 15(4) 551-7
[ PubMed ID = 22388962 ]
[ RRC reference ]
|
|